Description :
From Genome Similarity Track
Location :
contig_2:165196- 172564
Transcript NameFunction/comments
g582.t1XP_008902887.1 hypothetical protein, variant 1 [Phytophthora parasitica INRA-310
g583.t1XP_009523086.1 hypothetical protein PHYSODRAFT_488328 [Phytophthora sojae
g584.t1XP_009523085.1 hypothetical protein PHYSODRAFT_328487 [Phytophthora sojae
g585.t1hypothetical protein

Sequence
7368 bases(100 bases per row)
CCCGTGGAAGAGACGGAGCGTGTCATCAGTGAGAAATCATGAGTTTAAAGGCTGTTGCTGCAGCAGAGACTGACACTTTCTCTGGTGTTTGTACAGGAAC
GCTGAAACCTTGCTGGAACAACGACCATGACGGCGGCTTTGGAGGAGGTCCCAAGCAGTTGGGTCACACAGCCACTAACTACGCGTCGTGCTTGACACTC
GCTCTGCTGGGAACACCCGAGGCGTTGGAGACGGTTGACCGTCAGGCGCTGTACCGGTTCTTCCTCTCGCGGAAACACGCGGCCACGGGAGCCTTCACAG
CTCACGATGGAGGGTGCGTGGCGCTGTGGTTTTGCTGTATTAAGCAGCTTTGCGTGTAATTAAACGGTCTTCTCTGTGCCCAATCTGACAGGGAAGTGGA
TGTCCGCGTGACGTACTGCGTCGTCTCCATCGCTAACTTGTACGGTATCCTGACGGATGAACTGAAGGCTGGCGTGGTGGACTACGTGCTGTCCTGTCAG
ACGTACGAGGGCGGCTTTGGTGGCGAGCCGGACAACGAAGCCCATGGCGGCTACGCTTTCTGCTCCGTGGCGGCACTCTACATTCTCGAGGCTGTGGGTC
AGATTCGGGACCTTCCTGGACTTCTGCATTGGCTTGCGAATCGCCAGATGCCGTTTGAAGGTGGCTACCAGGGACGCACGAACAAGCTTGTGGACGGCTG
CTACAGTTTCTGGCAGGGTGCAGTGCCAGCATTGCTGGCTGACGTTGTGCGAGAACGGTACGGTGATGACGTGCCGTATCAATGCCATCAAGAGCAGTTG
CAGAAGTACATTCTGCTCTGCGGACAGGAGATTTCTGGCGGACTACGAGACAAGCCCGGCAAGCCGCGTGACCATTACCACTCGTGCTATTGCTTGAGTG
GTTTGTCGGTGGCACAACACGGAGATGGCAAAGGCGAGCCGGTCGTTTTTGGAGATGCATCCAACCTGGTGGCGCGCACGCACCCAGCGTACAACATTGG
CTACGACAAGGCTATGAAGGCAATCGCATATTTCAAGGCGAAGAGCCCCTTCGAACCGGAGTAGAGCAGGTAAAGTACCATGCCATAGATCCTGCGCAGA
ATGGTGCCAAATGGAAGTTTACCTGGTCGATGATCTTAACAAGCATTGCACTAGGCATTCACTTTGTGTTTTTGCGTTGTCATTTGTTATAAGGGTGGAA
GTTTCTCGGCTGTGTCGTCGCCATTAGCATCGCTACTAGTATCGTGGTCTTTATGGTTTATGCTACGCAGGGACGATGAGGCTGCCAGCTTGGGCAAAGG
AGGCTGAAAGTTCGAGGTCGATGAGTGTGAACCGTGGTGAACAGGATGGTGCGAGTGGGGAGATGGATTTACCACAGTTAGCGATGCTTTCCGCTTTTCT
CGATCCCGGACTGACAAAATCGTAGATGGCGATGAAGCTGCTTCAGTCAGCAAGATTGCCTTCGAGATTGATGATCCACTCCCCACATGCCGCTGCGCTC
TCGCTTTGGCTCGATCTTTCCGCTTCTGCCGCTGCTGGAAAGGGGTCAAGTTCGCGCCCTGACTGCTTGCAGACCCACTTTCCTCGTCGGAGCTCAAGTT
TTGTGGAGAGTTGGAGTGAGTTCCCTGAATGAGGCCGCTGCCTTTCACTGAAAATGGCTGCTGCTTGGGTTTGGCTTGGAGTAGCGTGGGCTTCAGCTTG
CTATGCGCCAGCTTGCCTTTGGGGGATGGCTTCTTGTCGGCTTGTACATTTTCCGAGTTGCTATCTTGAGGAGAAGCACCCAAGTAGTGGTCAAGTGACA
TTCCACTCACGTCGGACGTCGGTGCAAGCTTTTTCACCGTTGTAGAAAGCTGAGGTGGCAATGCCCGGAGAGATCCTGCTCTGGGCAGCTTTTCCTGTGC
AATGGCATCGACTTCATTCACGTGGAGATAGTCGCTCAGCGTCATACCCGCGAGCTCAGACGGTGGCTGTGCCTTTGGCGTGGAAGTCTCGGACTCGTAG
TCGTCTTCGTAGTCATCTTGCTCGCTCTTCCGCTCCGATGCTTTGGCACCTCCCGTCGCGAGTATCCGATCCGGGCCATCCTTGTCTTCGCCTCCGACTT
TTTCAGCTGCCATGACGTCGTTGTCGGTCGAGTGTTGAGCAAATGCTGTGACACATGACCGCTCACTTTGTGTGCAGCGAAGTAGTCTTCTAAGGTGGAA
CCTGCCAGTGCGTTCCCGTCGTCGCCGTCGCCCTTGCAGCCTGTCTGTGTATTCAAATGTTGCTGCTGTCCCTTGCCCATGGTACTGCAACCTGGCCGCC
ATCACCCGATAAGCCTGAATCGAGGGGTGTAACGACCATGCCGAGCTGAGTCGTTTCAAGTCCACTTCAACTTGTTCTGGGTTCGCTTTTAGGCGAGAAT
GTGATGCTTAGAGGTGGATGGCAGACTTCACAGCAGGGTAGAATGTTCAACGAGAGAAAGCAGTGACCATTGCGAAACTGTTGTTGATAAGCTAGCAGGC
TGTGTAATACATCAATCAACTCGCGCCGAGTCAAGTAATCTCTAGTCTTTCAAGCTTCGCTGATCCAAGGGTTAAGGACGTCTGGCTGGTACATTTCTAC
GCTGATGAATACCCTGGTGTAAATTCTTGCAATCACCACTGCAGTACCTTGAATCTATGCTGGGTTCTACCGTGTTCAGGATGGCGCTGCCACCGCCAAA
TACACTCAGGTTCGGCAGCTCACGCAGCAGGCTTGTTACCAAACCTGAAAGCTAGTAACCCTTCGTCCAGTCGACTTGGTAACGAACGGGTTCACCCTTG
AGGTAGCGGTTGAAGTTGTCCAGGAACATGGCTGCCACGTCTTCGGGGAAGACTTTGCCCGACACGTGCGGCGTCAGCAGCACCGAGGGGTGTTCCCAGA
GCTCGCTGTCTTTCGGAAGCGGCTCCTTCTCAAACACATCAAGCACGGCACGCGACAGTGTGCCCTTGTTCAGCGCGTCAATCAGTGTTTTCTCCGAGAT
GACGTCTCCACGGCCAATATTGATGAACACAGGACTGCGCGCGCGGCATTTCTCCAGGTTATCCTCGTTCAATAGATACCGTGCGTTTGTGCTCGGAAGA
ACGTTGAGCAGGTAGTCGCTCTTGGATAGCAGGTCGTCTAGACTCGTGGTGATGTGATCCGCGCACTCTGCAAGCTCAGCAACGTCCTGTGCACTCACGT
GGCGCTTGAACCCCAGCACTTTGTAGCCGCAGCTGCGCAGCATCTTGCCCGTGTACTGGCCAATGTCTCCGAGTCCGAGGATGCCCACAGTGACGGACTG
GGCAGGTCGAAAGCTGATCATCTCGACGCGTGCGTAGTCGCGTTTGCTTTGGAACTCCTTGGCCTCCAGCAGCTTCCTCTCGATCATAGTGACGTAACCC
AGCACGTACTGCGCCATGATCCGCGGCATCATACCGCCGGCCCGCGTCAATGTGAACTTGGGCAGCTGCTCTGCAGTCAGAGCATTGGGTCCCTTGGGCA
GCAGGTTGAGGTACATCTCCACGCCGGCGTAGGTGGCTTGCACCCACTTGACGTTGCTCAGAATGTGCTGCTTATCCTCCGGCAGGTTCTCCTTGGGGTC
GAGGAAAACGGGGCCACCGCCGTGGGAGTCAATGAGCACGATCTCCGCTTTCTCCACGACGCTTTGCTGCTCGGGCGTGAGGTCCCAAATAGGTCTACCC
GGGTCCACCATGCTTGGTCCGTGCAGTGGGTCCTGCTTGTTGCCCACCAACTGCGGCAGCGGGATGTCCACGAGTTCCAGTTTGCCAGCCCGGTAGAGTT
CACCTGCAGGAGTCTCGGAAGCAGCAAATTCCTTGCGGACATTGTCTCCAATGCCGGCAATGAACGTCATGATGGGCACCCGCATACACGAAGCAGTCGC
GACGGAATCGCCATTGGAAGACGTCGTAAACGCAGTCATAGCAGCGAACTGGCGAGTCGTTCGAGGCACCTCGCAAGATCGAAAGTGAGCTCCTCAAAAC
GGCAACGTATTTTAGGAGTAGGGTTATCAGATGGATACCCCTTTTTCAGCAACGTCAAACCTTACAAATATCAAGTAACAGACTATTGGTTGCGCAATGA
GAGTGTATGCTTTCAAAACACCATGATATGATGAGCGGCTGGAATGCAATCTCCATTAGGATATCCCACCACGTGTTGGTAATTATCTTGTGCTCATGCC
TGCGGCCTCGAAGCTCCGTGTTCCCATCGTGTCGTTCCTCAATGGAATGGGAACTGCCATTCGCAGCGAGTTCGCAGCGTCTTCCACCCCCGCCGGAGAC
CTCTTTCGTGCCGGAAAACTGCAACTCGTGGACGTGCCCGTGCCAAAGTTAATTGGCAACACCCAGGACCCCCTCAGCGGCCACAAGATGGACGACACGG
GAGCTCCTCAGTGGGATCTGACGTCTGAGCAGCAGCGCGTCATCGAGCAGGCCAAGATTGTCGTGATGGACCAACATTCCGGGGGGCCGCTCTTCCTCAC
GCCCGAGGAAAGTCTACCCAAGGACAAGAGAGACATCCTCCGGAACATCGAGTGGGTTCAGGGAACGTATGCAGGTGTGGAGCAGTATTTGAACCGACTG
CCGCACGGTAAGAACGCACTGCCGGTGGATCAACTACCCAAGTTCACGTTGACTCGTGCAGGAGGATTTCTGCCGCGGATCATGGGCCAGTACGTCTTCG
GATACGTCACGATGCTGGAGCGGATGCTGCTAGAAGCGATCGACTTTCAGCGCAATCGCACGTACGAACGAGAGCGCATGATCGGGTTCAGACCGGCGCA
GACCGTCACGATTGGTATCCTCGGTCTCGGAGACATTGGCCAGGGAGTGGGCAAGATGCTGCGAGCGGCAGGGTACAAGGTGCTGGGCTTCAAGCGCCGT
GTGAACTCCCAGCTCGACCTGGCGTTGGCGGCCTGTGCGGATCGCGTCACGCCGGATCTGGACGAAGTGCTGTCCCAAAGTGACTATTTGGTGAACGTGC
TGCCGAGTACGAGCTCGACGCGCTACTTGTTGAACGAAAAGAACTTGGAGCTTTGCCGAGAACGCAAGCCAGTTTTCATCAACATGGTCGGGGCGACGTC
GTTGCTGAAAAGACAATCATTGACGCTCTTGACAACGGTGTGTGGTCTCGCGCTGTTCTGGATGTCTTTGAGGAGGAGCCACTCCCGCGCGAAAGTGCGT
TGTGGGCCCACCCTTCTGTGCTGCTCACTCCACACGTGTCTGGCTACGTGTTCGTGGAAGACGTTGCCAGTATGTTTGTGGACAACTTTGATCGGTATTT
GCGCGGAGAGCCCGTGCTGTACAAGGTGGACTGGACGGCAGGGTATTGAAGACTCGATCGTGCTGGCGCTGCTTTGACGGAGTCAACTCAGCACAAGACG
AGCTTGAGATGATGTCGTAGCTCTGCTGGACGTCGTATTTAGATATATGCTCGAACTTTTCAAAGTGCTGTGAATCCGCGTGTGTTCAACTACCATTTGT
TGGCTTCTTTTTTTCAACATTTTCCAATTGTGAAACCAAAGTGAGTCCCTGAGCTGGGATCTGCTTGCCATCATCGCAATCACCCAGTCGATAGCGCCGC
CACCAGCTCGTTGTGAAGACGTTGGGTAGTTATTAAGAATGCTTGTAGCTCAGGTGTTTTGAGATTGGTGCTTCGTGCCACGATGCAAGCCGCTCCAACG
ATCTATAGGATACGAGAATTCAGATTTTTTTGGGGGTAAGACGCATTAAAAATGTAGTACTTACCTCGTAGAGCACGAAGTCTGAGATAATAATTAGTGC
AAGGACGACATGAAAAGCGTCGATTGTTTTGTGTTTTTACATAGTGGTTAGATACGCCTGTCTTCGCAAAGATTCTAACGAACTCCACTGAGTTGCAAGC
AAGTGTGATTATGCTAATGCATTGTATTGCTATTACCAGTGATACAAATGTGTCGGAGCCTGGAAAATTTCTTTTCATTCGTGTAGTACAACATCTTTAT
TGAGTTCGTGGAATACAAGGAATCGGAATACAAAGAATCCACACAAGAAGCTCAGTACCCCTTCGTCCAGTCCACAACATATTCCAGAGGCTCGCCACGA
AGGTAGTGATTGAAGTTATCCAGCAACACGGGCCCGACATTTTCCGGAAACACTTTGCCTGAAACATGGGCGTCAAATGTACTGACGGATGCGCCCACAG
CCCGCTCACGCGCGGCAGTGGCTCCTGTTCAACACATCCAACACGGCCCGAGATAAGACACCTGCATCCAGGGCATCCAGCAGCGTCTTCTCGGAAATCA
CGTCTCCACGGCCAATGTTGATGAACACGGGACTTCGTTCACGACATTGCTGCAGATTCTTTTCGTTCAGCAGATATCGAGTCGCGCTCGTGCTCGGCAG
CACACTGACAAGGTAGTCACTGTTCGCAAGTATATCATCCAAGTCTGTCGTGATTCGATCAGCGCAGAAAGCCAGATTGTCAGCCTCCTTGGGACTTGAG
TGGCGCTTGAAGCCCACCACGTGTACCCGGCAGTACGCAGCATCTTACCACACCTTGGCCAATGTCACCAAGTCCCAAGATTCCAACCGTCACAGACTGC
GCCGACCGGTAGTTCACCAGCTCCATCCGCGCAAACTCGCGCTTGCTCTGGAATTCCTTGGCTTCCAGCAGCATGCGCTCGATCAGAGTCACATATCCGA
AGACGTACTGTGCCATGATCTTGGGCATGACACCTCCACCCCGAGTCAATTGGAACCGGGGAAGCTGATCCAGTTTCGGTCCGTTGTCACCTTTGGGCAG
CAAATTGAGGTACATCTCGACGCCGGCGTAGGTGCCCTGCACCCACTTGACATTGTCGAGGATGTGCTGCTTGTCACTCGGTAAACTCGTTTCGGGGTCG
AGGAACACTGGACCTCCTGTATGTGAATCCATGACCACCACTTCCGCCTGTTCCACGACCTTGTGCTGCTCGGGCGTCAAGTCCCAACGAGGCTCGAGGA
GGTCCTCTCCACGCTGATGCTCTGCATACCCGGCGTCCTGCTTGTTGCCTGGAAGTTGCGGCAAAGGCATTTCCACGAACTGCAGACCCCCGGACCTGAA
AAGTTTTCCAGCGGGTGACGAGGACGACGCAAACTCTTTTCGCACAGTGTCCCCCACTCCGCGGATAAACGACACAATGGGAACTCGAAGTGCTGCCATG
GTCTCCGATATCTCAAATGTGCGGTGGGGAGAATCAACTTCCAACAAATCTAGGTTTGATTTGCTAGGATTTCAACTAAGTGCGAGTTGAAGTGTACTTG
AATGTCCAACCCTGTTTTGGCCTTCTAGCTGTCTAGGTGTCTAAATACATATAGGCAGTGTCTGCCTG