Description :
From Genome Similarity Track
Location :
Scaffold_525:16519- 20157
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_525-fgenesh-gene-0.1ADP-ribosylation factor
Pytir_DAOMBR486maker-pir_contig_525-fgenesh-gene-0.6DnaJ domain protein

Sequence
3638 bases(100 bases per row)
ACACCGCGGAAAGCATCGGCGAACGAGCACGAGTACCTGCGCCGCTTTGTCGACCCAGTGCTCATGCCGCTCATCGAGTCGCTGCTGCTGTACCAGCCGA
AGAGCATCTACGAGTTCATTCACGACTACGTGGACGAGTCGAAATCCGCGCGCTTCAAGAGCCACCCGCACGCGTTGGGGTACGCCAAGAAGCTCGCGAG
TCGGCGGAAGATGGTTGACTTCATGTCCACGAGCGTGATCCCCGTCATGGATGACCTCGCGCACCAGATCCTCCGCGAGAAGCCAAGCTCCGTGCAAAGT
AAATATCACTCTCTCAATAGTTACACTACCTGGCTGACACGATCTAGCGAAGCGCTAACCTCCTTCTATTGCTACTTGGAACACTCAGATTTCATCAAAG
ACGTGGTGGCAGCACGCATCATCGTCGGCAGCAGCTCGCCCTTTGACGCGACCTCCAACCAGCAGGAAGCCATCGAATACCGCGTCAACTATCGAGTACT
CTGTCGCTACAAGGGGCGACCGCGATACTACCCGGGCGTGATCTCGGCGGTGCATCCTGAGGACGATTCGTTCACAGTCGTATACAGTGACGGTCGTACC
GAGCAGCACGTGCACCGCATGTGTCTCAAGCCAGCGGTAGAGCAAGATAGCGAATCAAACCGGGGCGACAACAACAACCGGAAAAACAACAACAGTAGCA
TTGATGGAGACGCAACGACAGAAACAACAACAGCTAGCCCCGCGCAGCTGCGCTCTATAGAGATCGTGATCCTGATCATCGGCATCGACGGCGCAGGCAA
GACCACGCTGTTGTCGACACTGCAGGGCGATCTGGACAAGGAGCACGTCCCGAGCGCGGGTTTCACGTCGGCAACCTTCCAGACCGAGACCGGCTCGGCC
ACGTTCTACGACCTCGGCGGTGGGCCAGCGTTCCGCAACGTCTGGAAAGAATACTATGCCGATGTGAGTTTGCAGGGCGTGCCTGAGACCTTTGTCTGTG
TCACTATGTAGGAGGACTGACTTCGTGTGGATTTCTATGATGACGATGATGAAAGGCACACGCAGTCATGTTTGTCGTCGACTCATCCAGTGAGAACACC
GTGCACCAGTCGACTGCGATTCTGCAGGACTCGATGACCCACACGTTGATGGCGACGAAGCCGCTGCTAGTGTACGTCTATGCCTCTTAACATCGCTCGC
CTTCTATCAAAGGGGAACCTATCACGCTAACTAAGTCTCAACCATTTCTTGATAATACCAAACCAGGTTCGCCAACAAGCGCGACCAGCCATCTGCACTC
GCTGAGGACGAGCTCGCGCGGTTGCTTCAGCTCAAGCAGTTCCCGAACTCGAGACTCGTACCGTGCGTCGCCAAGCCCGGAGCGTTCAGCAACATGGTCG
ACGATCGACTGGAGCAGGGCCTCCATTGGCTCTTTGAGCAGGTGAACAAAAACTACGACGCTCTCAACGATCGCGTGCAGGCCGATCTGGCGGTCAAGAA
AGCCAAGGACCAGCAGCGACGAGCCGAGCAGCGCGCGCGGGTATCTGCGTGGAGAGAAGAGCGTGAGCAGAGAGAAATGGTGCTCCACGACAAGTCGTCG
CTGGCACCTCATGACGAGAGCGAAGTAGGTTCAAGTACTACTATGGACCAGCAGCAGATTGGAGGAGCCACAAAGGCTCAGAAGCAGGGCGAGCAGCCGG
AAGAAGCCGTGATTTACTGCTCCAACTGCACGTCGCAGCCTGCGGTGACGAAGTGCGCGGCCTCCAAGTGGATGCCCGTGTGCGCCGCGTGCGCCACCGA
GCTCAAGAGCAGTCGGTAGAATAGAATGCAAACTCTTCTAGACCCACGGAAGTTGGTAAAGATCGAAGTCTATTGCGAAGAGCTCAGCTGGGCATTTCCT
TATCATATCTATCTCTTCTTGCCCTTACCGCCTTTTCTGCGCGACCCGCGCTTGCCATTGCCTTCCTCCTCGCTGTCCGTCCAGTCGTCTGTCACTCTGG
AGCTCTTGGCCGTTGCGTCTGTTGTTGCATTGCTGCTGCTGTCTTTCTCTTTGTTGTCTCTGTCCTTGGCGTTCTTGCTCTTGCTATTGCCACCACCGCC
AGTCACGATCTTCTCGACGCCTTCCTTCTTCAGCTGCTTGCGCTGTTCCTTACGCTCTTTGCGCTTTTCCGCTGCCTTCTGCTCCTTCAGCAGACGCGCT
TCCTCTGCTGTGCGTGCGGCTTCTGCTTCTTTCTCTCTTTGCTCGGCTTCTTCAGGGGTCTCTTCCTGTTCTTGCTGCTCGTCATCCTGAGTGTCGTCCG
CCTGCTTTTCGCTCGTTTGAGCCGCCTTGTCCTTCCCAAAATCACCACTCTTCTGCTTGCGAGCCGCAGCGAGTTCAGCTTGCAACTCAAGCTCAAGCTC
GGCCTCAATCGAGTTGTAGTCGCTGCCGCCGCCAATGCCGAGCTCGGCCTCCATGTCGCGGTGCTTCTTCGAGACCAAGTGGTTACTCAGTTGCTTAGCC
GACTTGAACGTCTTGCGGCACAGGTCGCAGAGCAGCAGGTCCGCGTCCATCTTCTTGCGCATCCTCTCGAGCTCTTCCTCAATGTGGTCCTGCGCATGTC
GACTCGTCTGGTGGCTCTCCATGGCCTCCCAGCGCTCCCTCTCCTGTTGCTGGAACGCCAAGCGCTCGGCCTCGTACGCCTCCTGCTTCTCCTTCTTTCT
GGCTTCTTCGTCGCGCTTCTGCTGCTCCTTCTCCTTCTCCTTCTGCTTGAGGAACGCGATCATGCGCTGGTCGCGACGGCGCACAAAGTCCACGAGCTCC
CGCACTTCGGTCGTGAACGCCTTCTTCGCGGCGTCGCGCAGCTTCTTGTTCTCCTTCTCCATCGCGCGGCGGATCTGGCGACTCGGCGCGTCCAGCGTCC
GGTACTCGTCTACCCACGCGAACGTGCGCTGCGTGATGTAGCTTGCCCAGTACTGGTAGAAGTAGTTCACGTCTTCCATGGGCGTGCGCTTGTCGCCAAA
CGCCGGCGCTTCCTGGGGTTTGTTGGTGGACGTCGCAACGGTTGCAATGTCCATCTCGTCAATCTATTCATTCAATAGGACAACGACAGCAATTAGAACA
CCAGGTCTCCTTGTGCAGCCCCAGTAGGAAGGTTGCAATCGTGTTGTACCTTCTTGAAGAGCGCGCCGTAGACCGAGTAGAAGCTCTTCTCGTCCTTACC
AAAGCCAGAGTACACCGAAGGGCTACAACAAAGTACGTTAGTTTATCAACCCGTTCAAGACCATCAAATCAACGAGCATTAGCAGACAGTCGGTGCAACA
CAGGACAGCGCACATAACAACAACGCACCTAAAGTACTTGAAGAGGTTGAGCTCACCGTCGTTGCCCTCGCCGTCATTGTCGCCATCGCCATCGCCGTCG
CCGCGCAGGATCTGCTCGCGGTGGTCGTCATACCACTTGCGCTCGTGCGCGTCACTGAGCACCTCGTAGGCGCTCTGGATCTCCTGGAAGCGCAGCGTGG
CCTCCTCGGCCGAGATGTTGTTCTTCTGGTGCTTGTCCGGGTGCCAGCGCAGCGCCTGCACGTGGAACGCCTTCTTCACCTCCTTGGCGCTCGCGTCGCG
CTCCAGCGCCAGCACTTCATAGTGGCAGCGCATGGTTG