Description :
From Genome Similarity Track
Location :
Scaffold_86:16518- 21305
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.4Replication factor C subunit 4
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.13WD domain-containing protein
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.14Ras-like GTP-binding protein YPT1

Sequence
4787 bases(100 bases per row)
AGCGCGCCGGCGGCGCCGCTGCCGTGGGTCGAGAAGTAGTACGTGGTCTTGTATCCCTGTGTGCTATGTGATGGCCAGCCGAACTGAGGCGCTGCTTGGC
TGTAGCCGCCCGAAGAACGTGGACGAGATCGCGCACCAGGAGCACGTGGTCGCGACGCTCAAGACGTCGATCGCGAGCGGGCAGCTGCCGCACCTGCTCT
TCTACGGTCCGCCGGGGACGGGCAAGACGTCGACGATCGTGGCGGTGGCGCGGCAGCTCTTCGGGCCGGACTTCCGCAAGAACGGCCGCTTCCTGGAGCT
CAATGCGTCCGACGACCGCGGCATCAAGGTCGTGCGCGAAAAGGTCAAGGGGTTCGCACAGGGAGCAATCGCAAGCACGAGCGGCATGCCGCCGTTCAAG
ATCATCGTGCTGGACGAGGCCGACTCGATGACGGGCGACGCGCAGTCGGCGCTGCGTCGCATGATGGAGAACTACTCCAAGGTCACGCGCTTCTGCCTCA
TCTGCAACTACGTGAGCCGCATCATCGAGCCCGTGGCCTCGCGGTGCGCCAAGTTCCGCTTCGCGCCGCTCGAGAAGGGGTCAATGGCCACGCGCATCCG
GTTCATCTGCCAGGAGGAGCAGCTACAGGCCTCGGACGATGTGGTAGACGCGTTGCTTGACTGCGCGGCGGGAGACATGCGCAAGGCCGTCAACTTCCTG
CAGAGCGCCAAGCAGCTCTGCGGTGACGAGGAGCTCAGCGCGGACGACGTCGTGGCCGTCGCGGGGGTAAGCAGTCTCTCTCCCCCACTTTGAGTATTGC
TCATGACCATTGAGCCTGACTGTGACTGCTGTTGTGACACTGTAGCTGGCGCCGCCGGAGCTGCTGCAGAAGTTCTGGACAGCCGTCGCCGCCAACAACT
TTGAGAAGATGCGCGCCGAGATCGACGACATGCTCATGGCCGGGTACCCGGCGCTCACGGTGCTGCGGCAGCTGGGCACGGAGGTGTTGCAGGTGGCAGC
CATCGGGGACGTGCAGAAGGCCAAGATCAGTCTGCGGATCGCTGAGGCCGACCGGAAGCTCGTGGACGGCGCGAGCGAGCACTTCCAGCTCATGGACGTC
GCATCCTTCGCCATGCGCGTGTACCACGGCGGCGAGTGACGCGGCACAGACAAAACGACCGTCAAGGCTGAGTTTCTCATTTTTCTCCCTTCCCTCACTA
TCTTCTCTCATTCTTCTCTCTCACCTCTTCAACTCTCGGCCGATGGCAGCGCGCCGGCGTCCGTGACGCTCGCGATCTGCACCCACTCCTGCTCGCTGCG
CGCCTTCCAGAACGTCACCTCGTCGTCCCCCGACGCCACGCTCAGCACGGCGGCCGTGAGCGACCAGCTTATCCGATACACGGGCGACCGGAACGTGTGC
ACGACGTGCGACTTCCACTCGCCATTGGGCTCGTCCTGGCTCCAGGCGCGCACCGTGTGGTCGTCTGACGCCGACGCGATCACGTTGGCGGGGATGCCGA
CGTTCGGAGCCCACGCCACGTCGCGCACCCAGTCGTTGTGGCCGAACAGGCTCGCGACGTCCGCGCCGTTCGCGTCCGTGGCCGGCACCCAGTGGTTCTC
GCCCGGTGCGAACTGCCAGATCTTGACCACGTGGTTGCTCGAGCCCGTGACGACGCGCTGGATCGGACCGGCTGCTCCTTGCGACCCCGGCGCGTTGTAC
GGAGCCCAGCTCACGGCCGTGCACGCCGCGCCGTCCTCCGAGTTGATGAACGACGAGGTCGTGACCCACCCTTCCCTCGCGCGGGCCAGGAAGCTCACGC
GGTTGTCCGCCGAGGCACTCGCGAGGCACAACCCGTACTCGTACGGAGCCCACGCCACGCTCAGCACCGCGTCCGCGTGGAAGTTGTGCACGTGCTTGAG
CCGCCACTCGGTTGCAGCGCCGGGACCGACGGGCACGCCGGGCTGGTGTTGCTGCTGGGCCGCGAGCTCCTCGCGGTAGATGTATACTTTGCCATCTTGA
GCTGCCAGCGCCACGACCGAGCCGTACTTGGGGTGGGCCCACGCCACGCGGTGCAGCGGCGCGGCCGAGTCCTCGACGACACGCACGACGTGCTGCAGCG
TGTAGTTGGGGCTCGGCGCGCCGTCGCTCTCGGGGTTGGCGGGCGAGACGGAAGAGGCGGAGGAGGACGTGGCGCCCGACACGTCGAAGATACGGAACGT
GCGGTCCGCCGAGCACGTGGCCAGCCGCTTGCCGTAGTAGTCCAGCTGGATGTCGTAGATCATGTCCGTGTGCTCCGTGTCCACGAGCGCCGCGGGCGGT
TGCCGCGCCGCGGGTTCGCCCATCGGTCCGGCCGAGGGCGGTTGCGCCATAGCGAACGCCATCTTTCTCGGTTTGTATTGTGATTGTCAGCTTGTGAGCA
CAAGATGTGGATCGTCACACATTTGGATCGATCTACATGTAGGATTGTGGATCGTTGTATGTGATGATCCAGATTATAAATGTGGGGCGATCCACATTCC
TGTCACAAAAGCAGAAAGGCGACCCACAAAGGGCAACAGCCGCAATGTTCGCTGTGAATGGGCCGAGTGGACCCACCCAGCGCAACGAGCGGCGCGTCAA
GACGCCCGCGGAGGCCGAGGCTGATCGGCGGCGAGAGGACGACAAGGCGCAGCGCAGGCGCCAGCAGTTCTTTGAGACTCGCGAACCACTGCAGGCGAAG
GCAGCGTCCGCGGACGAACGTATGGGCAGCTCAGAATGGAGACTGCTTCCGCCGTTATCTAACATTGCCATGTGCCACACATGGACCTCACAAGGAGCCG
CAACTCATGCAGCGTCGGATATTTTCAAGGTCGGTCGAGCTCTGCGACTGCGTACTCTATCAAGCTGTCATTGCCGACACTCGGATTGATCGCAATGGTT
CACAGGGCTGCCACATTGTGTTCAACGGACGAACGGGAAAAGTGTCCTCGTAGGAGCTCGAATGCCCGCATCATTGACTCTCTGAGGCTTATGAGATGTC
CAACGTCGTCCTGCCACGCAGATACTATCTCACGAAGCTTGTTCAGGAGCACGGCGGCAATGTCAGGTACGAGGATGCAGTAGTGTGAACTCATGTACAA
CGCGCTTCCATTTCGATAACCACTCGACGACCAGCTCGATACAAATGACCAAACCGTCCCGCATCACACACATGGTCGGCTGCAACCTCAGCGGGTCGAA
GGTCGACAAGACGCTCAAGGTGAGCGACTGGCTGCCTTCGATCAGTCGTGCAGTGGTTCTGACTCATTGCTGACATGACTGCGCTGCGACTACTTGCCTC
AAAGAAACTCGGAAAGACCAAGTTTGTCAGTCCAGGTTTGCAGCGAGCTGATCTTCACCCACCAGCTGTGTGAGTCTCATTGGTGTGCGCTCCACCTGCA
CTGTTGCAGACTGGATATTGCAGTCCGTCAAACAGAAGAAGCGCCTGCGAGAGTTCGACTTCCTTGTCTACAAGGACACGGCCACAGCCGCTAGACTGCA
CGCGGCCTTCGCGCCGTCCGCACCCACTACCAACACAAACTCTCAAGCCGAGTGAACCTCCTCCGTGAGCCATGCTGGTGGGGAAAATATAGATTCACGA
CTAACAAATGTAGGGTGGTCTTCTTGTTCTCTTCTTCCAAAAGTGAGCCAGCCCGAGAGCCTGTGCGCCAGAAGCGAGCGCAAGCCGGAGCGAACACTCC
AGCCTCCGCCATCACGCGCCGACCCCGAGCTCGCCACCTTCTCCCATACGTCGTCCGTTGCCAGGCTGCCCGTCACGAATGTCGTCGAATCGGCGAGCAA
AATGGAGCATCGAGCTGCGGACAGCGCCGTGGAAGCCGGAATAAATGACGGCGCTTAGCAGCACCCCTTGTTGCCGCCGGGCGACACCTGCTGGCCGGGA
GCGAGCTTGACGCCGCCGCCGACCTTCGGCGCCGCAGGAGCGTTCGCCATGCGCTTCTTGATCTGCGCCGCCATCATCATGAACGCCTTCTCGACGTTCG
CCGCGTTCTTGGCGCTCGTCTCGAGGAACTCAATGCCGAGGCTCTCCGCGAACTCCTTGGCCGCGTCCGTGCTCACCACGCGCTTCGCCGTCAGATCGCT
CTTGTTGCCCACGAGCAGCTTGTTCACGTTCTCGCACGCGTATCTGTCCAACACACACACAAATGTTTGTGAGCCATCTCGTGGAACCACGACAACACAA
CGTGCCATGCAACACCCACCGGTCGATCTCATGCAGCCACTGCTTGACGTTATTGAACGACTCCTGGTCCGTCACGTCGTAGACCACGATGATACCGTGC
GCGCCGCGGTAGTAGCTGCTAGTGATCGTCCGGAAGCGCTCCTGGCCAGCCGTGTCCCACTGCAAGTAGCACAAAGATCCAACCCAGCTGTCAGTCCCGC
CATGCGGCGCCTAAAAGATACCGGACAGCGAAGGGACAACGTACGATCTGCAGCTTGATCGTCTTGCCGTCAAGCTCGATCGTGCGGATTTTCTACCATC
ACCACCGCGGGAAAGCTCTCTCGTCAGCAACCGTCGTCGACTCGTCCGAAGCACCAACCAAGAATGAAAAACTCACGAAGTCCACGCCGATGGTAGAGAT
GTAGCTCTCCGTGTACGTGTCGTCAGCGAAACGGAGCAGCAGACACGACTTGCCGACGCCCGAGTCACCGATCAGCAGCAGCTTAAACAGGTAGTCGCTG
CACCACCGCACGCGCGTTAGTCTTCGAATGCCTGGCAGAAAATGCGTCGACTCGCCACGACCACGTACTATTCCGGGTTCATCTTGG