Description :
From Genome Similarity Track
Location :
Scaffold_79:165118- 166574
Sequence
1456 bases(100 bases per row)
tcagcttgcgaatcttcttattctgattcttcatccagttcttcatactcaaaggcgttgtcttccgattcttcgtcggtttcctcatcgctgaaggtta
gcctatcggggactgggaacagctgataacacgctgggtactgcaagtcacggggttgaatattgcgcagattccgagcgttgtgcgccaataggcactc
gtagtcaaccgtgtggctacattgaggtccttccagcaccacccccgtggtgaccttgaggcaaaccacacactttggtggtgccgctacatgcttgact
attgttgaagtatcctctaaacagtgtgattatcttgaaatgatctctatcagatattatattgatatttaggacgtcctgtttaagctgtgatgactgg
cttaaattatgctagcaccaatggctggtgtgcagttactagagcctttctagagtaataaagcgcccacttcgtcttttgacgtctccaactaaagctt
ctctctccttgctatctacctgcctaccgagccataacaatcatcgcatcaccgtcttcaacttcaagatgcacgtaggcgcggcagccgtggttcaaca
gggattgtctgcttgatgcactatcggtggtacggctgccgacagctgtcttggtcacacccctatgtaccaccatcgagaggatccaggcatatgacgc
aatcggtaacaccgtcgcgcctagccttgcttggttcttggtgaccaggtgcctggacgagctcctcttccccattacccggacgaacttgatcatcttg
tgcaccttgaatcgcttggtggttgtcattgtcttggtgctctagcaacgatgtagtcatgtgcataatcgtcataaaccatatggatgaattgctacac
ggacaaaccgatttagcatgatcacgcctaagatcaagttgctcgtggtgacgccgagaaccaggtgtatgacgattatgcacatgactacatcgttgct
agagcaccaagacaatgacaaccaccaagcgattcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggagctcgtccaggcacctggtcaccaagaaccaagcaaggctaggcgcgacggtgttaccgatt
gcgtcatatgcctggatcctctcgatggtggtacataggggtgtgaccaagacagctgtcggcagccgtaccaccgatagtgcatcaagcagacaatccc
tgttgaaccacggctgccgcgcctacgtgcatcttgaagttgaagacggtgatgcgatgattgttatggctcggtaggcaggtagatagcaaggagagag
aagctttagttggagacgtcaaaagacgaagtgggcgctttattactctagaaagg