Description :
From Genome Similarity Track
Location :
Scaffold_214:1651- 3157
Transcript NameFunction/comments
Phyke_g6617hypothetical protein PHYSODRAFT_492736

Sequence
1506 bases(100 bases per row)
TGCTTAACTCACATTAAGTTGAACATTAACTTCCAGATGGCCGCCATGACGTGCAATAGGCACCCAGAGCACCAGCGATCCACCGCCTGTACCAGGAAGA
CCCAAGAAACCCGGACGCCAACGGTCCAGATACAGCGTCTTACCACCCAGCGTGGTGATGTTCGATGACCATGACGCTGTACCACCCGCAAATATCTTTA
ccttgtcgatcttgtcgccaccaGACATGATATTTACAGTCACATCTTCCGTGTCTTTGCTCGTGAAGTTAATGATGACTACCCCATCACCCTTCTTAGC
CCAGGAGCTTGTACTGCCTTTGAAAGCATCCTTCAGTGCATTCAAACCCAGTGTTGCATCTTCCGTTCCATCGTCAATTTCACCCAGGAATTGTGTGGGG
CCACAAATTGTCTGCAAGTACTCGGCAAACAGGGTCGACAGATCCGTCGGATCCAAACCAGTAACAGCAATGGTAATGAGCCCGTTATCAATCCACTTGT
ACGCAGTATTCTTCTCATCCATCGACGTGCCGTTGCTGGTTTTTCCACTTCTGATCAAGTCGTTGATAATAATACCGAAAGTCTTTCGCAATGTTTCACG
TGTGGTGTAGGCGGTTGTTTCGGAGGACTCGGCTGACATTTCGttcatgcagttgttggtAACCGTGGCGACGTCGTACAGCACGAAATCAGACTCACTG
ATCTTCAGGCGTAGGTCGCCATCACTGATACCAGGTTTTTCTGCCCTGTACTCATTCACTATTTGCCACGCTCGGTCAACCAAAGATTTCATGTCGAATC
CACAACTTGAGTTCTTCTGCATAGCTGTTTCGAGGTTGGAGATCTCACCCTCAGTAAtctcctcagcagcctcagTGAAGTTGGCCCCCTTCAAGAATGC
CTTAAACTTCTCCCAGCTCGAGATAATATCGTCGTCGTGTCCCAGAACATGCAGGAGGATCCACTGCGCAGTTGATAGTACACTCTGCGATAGACGAAGG
TTTGGTGGTATATCCTTGCCCAGACAAGCATAGATGGCAATGGGCAAGTCAGTAACCACGTTGTTCGTCTGGTACAACATCGTCAGAAGTTTTGCCTGTG
GCGTTTGAGGGTCTTCAGTCATTTGAATACGCGTGAACAGGATGATGCCCCTCAGCACAGAGAGCAATGAGTTCGTGCATTTGACGGCTCTTGTGACAGT
CTTCCCCAGCTTTGTCAGCTCTCCAAACACACCAAAGGTGGCCATGCTCAGAGTCGACATCGCCACAGCAGAGGTTTTGGCAAGAACTTCACGCTTGCAG
TCGTTGTTCTGTTGAATGCACTCCATACCACATTCAACCGGGTAACCGAGCGGACACTCCGTCCAGCAGGTGTTCGTTAAGTCATTGCGGTCGAAGTTAG
ATGGACACGTATCCATGAAGTGAGCCTCGCGGTAACAAGCTGCGTCCGGTGAGAGACTCCAAGGACCCACCCAGTTACGGTGTGTCGACGTGATCGTGCT
CGTCGC