Description :
From Genome Similarity Track
Location :
Scaffold_4:1650367- 1655494
Transcript NameFunction/comments
Phyin_T30-4PITG_03413Putative uncharacterized protein
Phyin_T30-4PITG_03414Cysteine protease family C01A%2C putative
Phyin_T30-4PITG_03415Cysteine protease family C01A%2C putative

Sequence
5127 bases(100 bases per row)
AGCTCTATTCCAGGTGACGGTTTGCTCTGGCTGTAGCATTTCTTGCCAGTGTACTGAGGAAACCCTGCAGCGCTGGACGCAGGATGAATCTGGCGAATCC
ACCGCAGCAGAGAAGGTATCCCAGCACTGATGGCTCCATCTTGAGCGACCAGATCACTAGCGTAGCAGGGGTGCTCTCTGGGGACGCCGCTACGTCCACG
AACTGCACGAACGCGAGGTGGTCCTGGATCGGGAACACCCCAAACTTGTGGATCTTGTAACAGATCGATGGGATCTTGGAGTGATCTCGGCGGGCTGCGG
CAAGACTCGGTCGCCCTCCATCGCTGTCTACGGGATCATCAATGGGCAGCCCCGCTGATAGAATCTCCTCTTCAATGCCCAGCGGGGCTCCCCGAACGTG
GCCGACATAGCCTCGGCCTTCGCCCTCGTGCAGCTCCGAGCCCCCCGCCAGCCAAACTTGCTCCAACCATGCGTCAAACACTTCAGAGGGAGAGCCGACG
ATGCATTCGGATACCACGAGCTCCTGGCCCTTGTAGTGCTGGTACTTCTCGAAGGCTTGCGCGTCTACGTATCGCGTCGGGTCCAAATGATTGCTGCGCA
TTCCTCTCGTCAAGTGTAGCTAGCAAAAGTTGAACTCATTTGCTGTTTGGATATTATGGCCAATAGAAAGGACCGCCTACACGTCTTGTTTGCTCTCTTG
CTTCTTGGCAAGCGATCGTAGGAATGTCCTCAGCGCTAAACGAAAGACCAGGCGGATTAAACCACCGCAATGCAGCCAACTGCACGCCCTAGACATCTCC
GTCTTCACTGTCCACACAACGAGAGTTGTAGGGGTTTTGCTTGCTGCCACCCCTGAGGTCCTTAGGAAAAAGCGCACCATAGCCAGATGACTTTGCAGTG
GGAATGGGCCAGGTTTGCAAACTCGGTAGCAGATGGATGGGATCTTAATACTTGCGCTTTGCTCCCCGACTGACGCTTCGGGTATCCCCGCCGACAGGAT
CTCCTCCTCCACATGCAGTGGCACTCGACGCACACTTCCGACGTATCCTCGGCCAACACCTTCGTGCACTTGGTCTCCGCCAGCGAGCCAGACGTCATGA
ATCCACGCGTCGAAAACTTCCGCTGGTGTCCCTATCACCACTTGGGACAGCTCGAAATCCTGACCAGTCTGGTTGTCGTACGCTTCCAGCCAGAGGGCAT
CGATGTAGCAATCAGAAGGAAGCATCTTGACGTGACTTCAATTGTGTCTACGAACCGATTAGCTTTTATAGTGGTGCCTACCGGTGGACATTATTCACTT
GGTCCAACAAAGAAAAGGGAAAGCTGTATCTGAGCGGCGAGATTGGTGCTGTTGTCGCTTGAGAGCTATTGATCTATTGTTATTAAGACTTACAAATTCA
TTCTGATCTTGTCCATCGGTGTTTGTGCGCAATTTTTGATCGACTACTACTGTAGTAAAAGGTTGCCGTGGCACTGATTCACGACATTCATATAATTTAC
AGCGTCTCCTTAAAGGCGTTACGTTGGCGACTGGCGTAGATGACCCCAATTACGGTGAGGAAGAGCGTGACGACAGCTACTGCAATCCCACAAACGATCC
AGCTGTCAGGTGACATGCCCACGAACTCAACTTCACCTCCTCCATCAACGGCCGTGTGTGCCGCGCCAGCTATTGCTCCGGTAGGAATCACAGGGAAAAC
ACTAAGGCCACAATTAATTTTCGAGTCCATTGCTAGCCTCAGAAACCCTTTCTCCCCCCATGACGCGCCGTACGAGTTCTTAAGAATCCAATAGTCTGTG
GAGCCGTCCGAGCCATAACCAACAAGCACGACGGCGTGGTTAATATCTCCGCTTGATGCGAAATCTCCATCGTTGGGGCAAGTGTAAATGCCGCCCTTGT
AAGCATCAAAAGAGCCGCCAGAGTTGATAGCCACTGAAATAGGCTGTTGCTGCAGTACCAGTTTGAGCAACTCGGTCGAGTCGCTGCTCAGGTCGCACGA
AGGTCCTGCTACTTGCTCCCAACCAGAAATGCTAGCAGCAGCGTTGTCACTTGACGAGTTATCGCATGCGTTTGCTAGAGTCGCAGCGGACGCCTGTGAT
GTGTCCTCTTCGTTGTACGGCAGGTCCAGTTGGCTCAGAAGCGACCAGTGCAATTGCGCTGCGTCTGCGAAAGCGGCGTGGGTCATGCCTCCACTACAGG
CATTGTTCCTGGACCCCCAAATCATCTTCGTTAGCAGCCACGGAGATCCATCTACTCCCCCATCAGCCCAACAGTAGTCGAACGTAGCTGTCATTTCCCT
GGAGCTGCACTCTAAGAATTGCTGTGGAGACAATGACCGCGGAGACGTTCCTGCATTCACCACCACGGCGGTCTCGATGGCATCAGCCGCCGCAAATGCC
CAACAACTACCACATTGGTTCTGACTCTTAATATCAGTGCAGATGCTCTGGTTGTGTGAGTTGTCCTTTGAGCACCAATCTAGTGTCTCTCGGATGGCGA
GTCTGCGCTGTTCTGTCAGTCTGCGTCGCTGTTGACGCTGTGATGCTTGATGCTCCTGCTCTACGAAATCGGCAGGTGACAAACTCCGGCTGCCGTCATG
GTACAAATGCCGCGAGTTGACGCCCATAGCGTACGAGAAGGCCCAGTCCCGACCAGCCGCATGCTTCTGCACTTGTTCCAGGTAGTCCACGTGATCTTCC
ATTCTGCGCCTGAACTCGCTCGGGCCTGCGTCCATGCCTTCATCCTGCAAAAACTGCGTCACCATCGTGTCCGAGGACACTGCGACGCCATCCCGGTCTG
CCCACAGACAGCGCGCGTCATCGCAGCTCTGTAGTGTTCCAAAGGAGGAAGGATCTTGAGCCTGAGTAATCAACGGAGCGACGGTAGCTGCCATCAACAC
TAGCAGAGTGGTCCACGTCGGCGCCATTTTCAGTTGCTCAGTTAGACCACTGACCTCGGAAATGGCAGATGTGGGAGTGATTGTTGCCTTGAGCGTTTGA
TTGCGGCAGATTTAGGGTACGACCATACAAACTTTAAGATGTTGTGAGTCAGCCGATGGGGCACGTTACCCACGCGCTATGATGGACTTTAAACGAGCGC
CTTCAAAAGGCTTTCAGGATCGCAGTTGTGAGCTTCAAGACTTGGCGTTGCAAGCGTATTATTGGCGTTTGCGGGACTGGGGGCACTTGTTGAACCGTCC
CAGGCGTCCTGCATGGGACGTCGCTGGCTCCTTGTTGTACATGTACGTGGTGCGTTGAGTTGGTCGTCTGCAACGTTGCACGCGCTGTCTGGATTCTCAG
CCACGTCCCCATGTGATTCACGTTGTGAAGGTCCTGAACCAGCCTGATTATGGATTTGTAATAAATAGGGTGCAGGCGCTGCTCTGACACGCTTCACATC
CTTTACTTTTTGTTGTTTCTGTAGTCGGCAAGATTTATCGCATTTGAGCGTTCACAGTGGAGCTCATATTCCCAAGGTGGATACGTGTATATTACCAGCA
CTGCTCTCTCAACTTGGTTCAAGTCCTAAAATCCATTTTGGGTATTCGTGGGAGTTCGGGCCGCGTACATGGCCGAGTTCTGCTTGCGGATTACCTTCAG
CTTCCGCTGTGACACTCCAATACCGATCGCCGTCGTAACCAGCGTGAAAATGGTGGTCGCGGCTGCAACGCCGATCCACGCCGTTGGGCTGAGACCCACG
AAGATTTTATCTCCACCGCTGTCAACAGTCGTGCTCGCTTGGGCACCGGCTTTCGCGCCAGTAGGAATAACGGGGAACACGTTCAGGCCACAGTTAATCT
TGGCGTCCGCCACAAGCTTCATGAAGCCACTATCTCCCCACGAGCTGCCGTACGAGTTCTTGAGGATCCAATAATCACCGACCGACGAGTCCGTGCCATA
GCCCACCAGCAGCAGAGCGTGATTCAGGTCGTTCTTGGAGGCCATTTCGCCATTGTTAGGGCAGTTGTAGAACCCGCCAGCGTACTCGCCAAAGCCGCCA
TTTGAGGTGATAGCCACAGCGATCGGCTGCTTCTCCAGTGCTGAGCGGAGTAGTAAAGTGCAGTTCTTAGAGGCAGTGCAGTCACCACCCACGATCTGCT
CCCAACCAGTTATACTAGCGGCTGCTTGATCCGCACTAACGCTGCACGATGAGGACAAGTTCGTTGCCGACGAGCTTCCAGAATTAGAGTCGTCGTACGG
CATCGTAAGCTCTGTCACCAGACCCCAGCCATTCTGAGCCGCATCCATGAACGCTCCGTGGGTCATGCCGCCATTGCACCCGTCGTTTTGCGATTCCCAC
TTGATCTCGGTCTGCATCCAGCTGGCACCAGCCACCCCACTGTCCGAAGCCCAGCAATACTCAAACGTTTGAGTGGTTTGCAACGAACTGCACGTGAGGA
ACTGCTGAGGCGATAACGATACGGCCGCCGATGCATTTTCAGTGATCACCACAGCAGTTTCGATCGCGTCTGCGGCTACGAACGACCAACAGCTTCCGCA
GCTTTTTTGGCTTTTCACAGGCGAGCACACGCTGTGGCCCACCGAGTTGTCTTTGTCGCACCAATTCCAGTATTCCGAGCTCCCTGAATTTGAGATTGTG
CTGTTGTTTGTACTGTTTGCTTCCTGTAGACGACGTGAGTTTGCGGAGGTCAATTCCTGATCCACAAATTGCTCGGGCGTTAACTTGCGCGTGGACGACG
ACGTCAAGTGGCGATCGTTCACGCCCATGTGATACGAGAAATCATGACCTACTTGCCTTGCATACATGCTCACATCTGCAAGTATAGCCTGTTAGTACGA
TATTTTTTCTGGGTCAAGTAAAGCTGTCATTTCACCTTCGATATACGTCATGTGCTCTTGCAGGTTGCGTCCGTACGACTCTTTGTCACTGTAGGCCACA
TAGTTGCGCTCGATAAAAAGCTCGCGGAGTGATCGTGAATCAACGACTTGGCCATTTTCTCCAGCCCATAGGCACGGCGAGTCTTGAGATCGAACACTAG
GACAGTCCACAAGAGTACCTACAGATCTGTCCGTAGTCTGAACGGCAGCACCGTTGACAAGTGCTGTTGAAATAACGAAAGTGATGGCTCGAATCTGCAT
GCCCCCTTTGAGTCCGTGGTCGCAGAT