Description :
From Genome Similarity Track
Location :
Scaffold_1309:165- 1999
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1309-fgenesh-gene-0.0Serine hydrolase (FSH1)
Pytve_DAOMBR484maker-pve_contig_1309-fgenesh-gene-0.1Serine hydrolase (FSH1)

Sequence
1834 bases(100 bases per row)
GCCAAGAAGCTGCGCGTTCTCTGCCTGCACGGGTTCCGCACCAATATGGAGGTGATGCAGGACCAGACGCGCGGGCTTCGCGAGGCGCTGGGCGACGCAG
CCGAGTTCGTGTTCTTGAACGGACCGTTCGAGGCGGAAGGACCGAGCGACAACGACATTGAGCGGCGGTACGCGAACAGAAAGCCGTTCTACGAGTGGTG
GCGGATACAGTTCCACGACGGCGGCGACATTGAGGTGAACGACGCCGAATCCTCGGCTCAGCTTCGAAAGGACGCCGAGGACGACGCGGAGGAGTGGAGT
CTGCTCTACGGCGGCCTGGACGACACGCTCGCGTACATGGACGAGCAGCTCCGCACGCACGGGCCATTCGACGTCGTGGTGGGGTTCTCTCAAGGTGCAG
TTCTCCTCACCGTGCTCTCCATGTGGTACCTGCAGCACCAGAACACGCGCTGGTGGAAGCTCGCCATCTGCGTGTGCGGCGTCCCCGTGATGGCCGTCAA
CTGCCGTGAGCTGTTTGTGGACGAGCACAGACGCCCCATGCTCGTGCCGTTTCCATCTATCCACCTGATCGGCCAGAAGGATCCGCTGTTCGACGAGTCG
CACGGCTTGGCCGCCATGTGGGAAGACCAACCGGCCGGCGCCGCCTTCGACAAGCTCGTGATCGAGCACGACGGTGGCCACAAGTTCCCGTCCGCCAGCG
AGCGCAACCAGCCGTTCTACGAGCAGCTCGTGCGTCTCATCCGCCAGCAGTGTGACCGCGACGCGGACCCATGCGCGTCAGGCTCGTGTCCTAGCGCGAG
ATTGTAGTCGATCCACCTCCGTCTTGATTGTGTAGCTACAATACTGACAACGAGCTTGATGGATTCGCATTGCGCACACCAATCTCGCGGTCAAAAAGAT
GAAAAGCGAGTGGGCCATAAAAACAGGGCGTGACTCCCACTCTGTTACGTCAACAGCGAGCTTCAACCTGAGCGTTCGCGCATGGACCAGGCGAGAACAG
ACACAGAATCGCTCAAGCCGAGCCACCGCACAAGGAGAACCGCCGGCCAGCAGATTCGCGGACATTGCAGCCGCCCCTCGACGATGTCCACGCCTCCCAA
GAAGCTGCGCGTGCTGTGTCTGCACGGGTTCCGAACGAACACGCGCGTCATGCAGGACCAGACGCGGGCGTTGCGCGAGGCGCTGGGTGACTCGGCCGAG
TTCATTTTCCTGAACGGCACACGCGAGGCCGCAGGACCGTCGGACGTGACGATCGAGACGCGCTACGCCGCGAGCAAACCCTTCTACGAGTGGATGCAGA
ACCGCATGTTCGACGGGAGCGAGTTCGAGCTGGACGACACCGTCGAGAGCGCCAAGCTGCGCGCCGGCGGCTCGCCGCACGGGAACGACTGGGGACTGCT
CTACCTCGGACTGGACCAGGCACTCGAGTACATGGATGAGCAGCTGCGTCGGCTCGGTCCGTTCGACGTCGTTATCGGCTTCTCGCAAGGCGCTGTGCTA
CTCACCATCCTGACCATGTGGTATCTGCAGCACCAGAGCAAGCAGTGGTGGAAGCTGGCTGTCTGCGTTGGCGGTGTGCGCGTGAGCGGCATCAACTGCC
TGCCGCTCTTCACGGACGAGGCCGACCGCGAGATGCTTGTTCCGCTGCCGTCCATCCACGTGATCGGCAAGACGGACGTGCTGTACGCTGAAGGCCACAA
GCTCGCCGACATGTGGGTCGACCACCCGCTCGACGCGCCGCTACCGAAGCTCGTGTTCGAGCACGATGGCGGCCACAAGTTCCCGTCCGCCTCACGCCAC
AAACAGCTGTACGCCGACGTGGTCGCCGCCATCA