Description :
From Genome Similarity Track
Location :
Scaffold_239:165- 1528
Transcript NameFunction/comments
Hyaar_Emoy2813065hypothetical protein

Sequence
1363 bases(100 bases per row)
TTTATTCCACTGTCTGCTAGCGCGGAGGTAATAGCCACAGGAACACCACGATCTAGTGAAATCAAGTACAAATCGTTCTGGATCCTTTGCATCTCAAGTA
GACAACTGCGCCTGCAAGGTCAGTCTTGTTGGATGCAATTACCAACGAACGTCCCTCTTCAATCATACACTGTGCAGCATTAAGGTCCATGTGAATCATA
TTAGGCTTGATCATATCTACTACATCGACCAATACCCGAGCCGAGTCGATTGCACAGAAAGCATCACACGACGACAGGTTCTCAATCTGGGTATCATGAT
AAAGCTTACTGTATCGCCAAATACCTGCTGTATCCACGTCTCAATGGGACTTCCATGAAATGTCCCTTGCACTTTTATCAATTTAAGCGTCACACCAGTC
CTAAGAAAAGGATGGCAACTCAAATTAGCGTGTAGTGCACCATGCTAATTCATCGCGTCTTTACGTACTCAGGCCCAATAAGAACGCGATCGTTATGCAC
AATCTTGTTAAGCAACGTCGACTTGCCGACATTCGATCTACCAGCTTGATCGTTTGCGGCTCAGCAGAGTACGAAAATATAAAATACCTCAAAGCAAGTT
TTCTGTAGCCCCACTCCCATCTAACCTGATCCCGCTGCGTACGCAACCTTTTACGAGCGAAACCTTTCCTACAAAAGAGCGTGAATTTAACAAGAATTAC
GAATGTTTATAAAAGGTGTCCATTAAGGATTTTATGGGCGTGAATTTGCAATTTTCAATATGTATTAAGGAATCACTCGATCGCCGCTTACTACTTGTTC
TTTCGCCTGTAGTTTTACCCAAATATACTACAATTACCCAATAATCCACTTATTTATAAATTACTCGCTTGCCGCTCCGAAAAACACTTGTGTGTTTGCC
GAAAACAGTTTTCCTATATATTCATCTTTTAATCGTTTCGTACCATCGCTTCTTGTTTGAGAATAGAAAAGGGAATAATCCAGCGAAGAAGCCGTAAGAG
GTGCGTGAGCAGGTGGACACGCAGACGTATAAAGAAACTCAAGCGCAATCTTATAACAATATAAGCATGTATATGAGTATAGACACCAAGCGATGAAGAA
GCGCAAGATTTCCAACATGGTTGAAATTGTGGCGCTTTGAGAAAAACTTAACGCAGTCAACTACAAGGGTGAGTGTCAAGAAAAAGAAATGTGCTACTTC
CTCCTTGCTCTCGACCAGATGTCTCTCGTTACCACGGTGAACGGAAGTTTCTTTTTATTCATTGGGTGGAGTATTCTTTGCGTTAATAATATCTCCTTAA
TTCTACAGAAATAGATAAAAACGTGACGACAAGGTTACCCGCGTAAAGGATACGTAGCCCTGT