Description :
From Genome Similarity Track
Location :
Scaffold_4129:165- 1171
Sequence
1006 bases(100 bases per row)
ATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTT
AGTACACGCCTCCAGTAGAGATGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACA
GACGGGGTCTCAGAATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGA
ACTTATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCATTCGAACAGGCCAAACGGTGTGAT
GAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCCGAAACCACTGGCCATGTCAAGAGAACAGTACCAGAGTAATTTATCCAAATCTTCC
AATAGCGCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCGATGCACAGACGTATATCCACCCCGTTCTTCT
TGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAGCCGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGACCGTTTCTCTCGGAA
CTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGTGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCT
TTACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCG
TGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCAAGATCTTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTC
ATCTTC