Description :
From Genome Similarity Track
Location :
Scaffold_319:16498- 17642
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_319-abinit-gene-0.24Serine protease family S08A

Sequence
1144 bases(100 bases per row)
CGCCAGGCGACCGCGATCAGGAACAGCACAGCTAAAGTACCGACGATCACCGCGCCGATGGTCATCCACGGCTGCCAGAACTCTTCATCGGCATTGGACA
TCGCCGTGGTCTCCACAACCGACGGGGACGACGACGCCACGAGCGCGAACGTCTGGCCGGTCTTGGCGCCGGCCTTGACGCTGTAGCCCGCCACGACGGC
TTCAACAGTCACGCCGGACTCGCTCGTCACCTTCACGCCGGCGAGCTTCGCGGCTTCGGCGATCTGGTCATAGGTCACCTCGACCATCTCGACATTGTTC
TTCGAGTCCTTCGTGCCGTTGCCCGAGAGCGGGTAGAAGACCTGGTCGGTACCGGGCAGGCGCACGCTCAGGTCCAGGTCGTTCTGAAGCGCGATCTTGC
CGCCCATGGAGCCCGCCGGATCGGTCCACACGAGCGTCACGCGCAGGTTCGCGCGCTGCTTGAGCACAAACGAAAAAATCGCTTCGCCGCCCTCGACGAC
CTTGGGCTCCGAGTTCGCCGACGAGTTTGGGTAAAAGTACACACCCGCACCGGTGCCGTTGTCAGCGAAGCTCGCGAGGTTGAGCATCGTCGGCTTGCCG
TAGCCCTGGTTGAAGTCCGGGTACGACGTGAGCGACAGCGCCTGAGACTCCATCGCGACACACGAGGTGATGCCGTTCTTTGGCGCAACCAGGCGGCGCG
TAAGCTTCTCGCCGCTGTGGATGATCAGCGCCTTGAGCAGCGATGCCGGGATCGTCTCCATCGCGTACCGAGGATCCTTCACGCCGTTCCTCCACCAGCC
ATCGCGCAGCCACTCGTAGAGTAGCACGGCCATACCTGCGACCACCGGTGTCGCCTGCGAGGTGCCCTGCAACGAGCAGATCGCCGTCGACTTGATGGTC
GATCCCGGGGCTTCCGACTGAGACGAGTCCACCGCCATGCCGGGGGCGACAATGTCGGGCTTCATGCGGCCATCTAGAGTAGGCCCGATCGATGAGAATG
ATGCCACTGTCTGCTTGTTCAGCACCGCGGGGCACGGCGTCGACGTGAAAGACGCCGCGTCGTTGAGCGAGGCGCCGATCGAGAGCACGTTCTTGGCACC
CGAGGGCGAGCTGATCGTGTGTGAGCCTTTGTCGCCGCTGTTAC