Description :
From Genome Similarity Track
Location :
Scaffold_370:16490- 22687
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_370-snap-gene-0.15Leucyl-tRNA synthetase, cytoplasmic
Pytul_var.sporangiiferummaker-pug3_contig_370-snap-gene-0.9Conserved gene of unknown function

Sequence
6197 bases(100 bases per row)
GATTGGTGTCCTTTGCGACCTCGTCCTTGAGGAGCTTTATGAAATCCACAGGGAACTCCTTCGTGTCGGTATTAAACACACTGTTCATGAACACCAACAC
CTTTTGTTGCCACTCTGGGAACTCTAACGACAAGTACACTTGGGCGTGCGTTGGCTTCAGTGAAGCAACATCCGCTGCTGCAGGAGCTGCGCTCTTTTTG
CCCTTCTTCGGAGCACCGCTGCCCTTGATGAGCGCCTCGCGGAAGACGNNNNNNNNNNNNNNNNNNNNNNNNNGAAATCTCCCGCGCGCAAGAGTGCAAA
GTCCACTTCGTCAGCCTGAGGCCACGACGCGACCGACACAAAGCCCTTCTTACCGATAAGCGCCCACACATGCTCGCAAAAGTGAGGCGTGATCGGCGAG
AGCATGATGATCTGGGCTTCAATAAAGCGCATGATCACGCCACGGTGCATGGCCACTTGACCACGACTGCAGATCTCACGGTACGTGTCCCGCGCAATCT
GGAACTCGAAGAATCCCGTGTGCAGACCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATTGATCA
AGTTGCTCATTTGGTGCAAAAACACCCGGTCACTAAACTGCAGGTCGCCCGTCCGCAGCGTCGCGGCTTCGTCGTAGGTCTTCTTGATCCACTCTTCTTC
GCTCGTGAGGCGCAAGATCGCCATCTTACACGTCTCCAGAGCGTAGTTGGCATCGTCCATGCCGTCGCCCGCATCGGCGCATGCGAACCGTGTGGCATCG
GCGCCAAACTCCTTGGCGCAATCCTTGAGTGTCAGAAAGTTGCCGGCCGACTTGGACATTTTCTTGCCATCGACGAGAACGTGGCCATTCGTAAAGATGC
CACGAGGCCACTTGGACGGATCGTCCCGCCAGATCTCTGCGTGGTTGTACAGGCACATGGNNNNNNNNNNCAAGTGGTTTCGAATCAAGTCCTTCCCAGA
TGCGCGAATGTCCACGGGGTACCAGTACTCAAACTCGGCGCGCAGCTTCTCCATGACCGCAATGGGGATCGTCGACTCTGTCGGTAGCGCATGACGCAGG
AAAATGTAATCAAACACGCCCTTCGTCAGTTGCTCGGCCTTGATGCCATGCGGACCGCACTGCGAACCGTCCAAGCTGGCTTGCAAGTGGTGCGCAATGG
TGTAGTACGCCATGTAAATGGTCGTGTCTGAGAGTGACTCGACGACAAACTGAGGGTCCCATGGCAACTTAGTGCCCAGACCAGCTTGCCGGCATGGCGC
CCATTCCTTCAGCCACTCCAGCGTCGCCTTGTATTCGCCCAATGCAATCGGGTTGTATGCATCGAATGCCGCTGGATCGCTGATGTGTTCCAGCACACGC
TGCTTCCAGTCATCGGCGCCGTACGTGAGGTACCACTGGTCCAAGTGGGCGACGACGCACTCGTCCCCACTGCGCGACATCACGAGCGATTCCGGTTCCC
AGTACGGGATGGCGTCGTCAGTGTCGAGCAACTCTTGACGCGCCAACGGCTTGGCGTCGCAGACCTTCTTGCCCTTTTGCGAACCCACGAGCAGCACGCC
TTCGTAGAAACCCTTCAGGTACACCAACTCCTTGGCCTTGAGGAGCTTCTCCTTGTCGTTTTGTGACGCGATCTTGAGATCGTCGCACACCCTTTGCGCC
GCGAGATCGCCATATCCAGGGATGTCGATGATGGGCACGATGTCAAACGGCAGCACCATGTGATCCGCGATATTGTACTTTTCACGAAGCATGGGCCTTT
GTTTCAGGTCACGGAACGCCGCGTAATCGTCGGGGGAATCCGAGGGCACACTCATGACGATGCCCGTACCTTTACCCATCGAGATGGTGAGCAATGGCAG
CGCGTATACTGTTTTGTAATGAGCGCTAGGTGGCGAGAGCGGCAAGCCCAGCAGATCCCATCCTGTGANNNNNNNNNNNNNNNNNNNNNNNNNGTTCCAG
GAGACACTCTTCCTGGCCCCACTTGCGCGAGTACTCTTGATGAGCCAGGTTCTTCGCCGCGCGGTGGCTAATGATGAACACTTCGTTGTCGCTGATCAAG
AACGCGCCGTAGTCGCCGTCAGGGAGAACGAAGCAGTTGGTTTGGCCAAACACAGTTTCGGGACGCAGTGTCGCTGCCCCCAGGTACACGTTTTTGCCAG
CCAAAGGCGCCATTTTCTCAGGAAATGGCTCTTGCACGCGGAGCTTCACAAGCGTATACTCCTGCGGCCCGACGCCTTCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAACCCAAAGCGCTTCAGATCGGCCACGGCTTGCGGAGAAAAGTACTGCAACCAGTGCAGTGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACAAAGCGCGGGATCTCGTCTTTCGGGATGTTCGAGAGCTTTAAGATGTCATACTGGTGCACGATGCCGCCGGTCT
TCGCCATGGCCTTGGACTTCTTGCCCTTGGCCTTGTTCTCCGAGCCTTCGNNNNNNNNNNACGGCCACGCTCCTTGAGCGTGTTCAATTGCCAGCGGATG
AACGCATCGTAGAATGGGTTCACGTCCGTCGTGATGAACGAGCGGCGCCAGTCGATGTTCATGCCAAAGCGCTTCAAGTCGGCGATGGCGTGTGGTGGGA
AGTACTGCAACCAGTGCAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGCTCGAGATCTCCTCCTCCGGGATGTTCGAGAGCTTCATGAT
GTCGTACTGGCGCACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGTACGTCTCGAGCTCATTCTTCAGCTTGTTCGCAGCCGACTGGATC
GGCATGNNNNNNNNNNCTACCGACTGCTTGACGTCCTCATCCACACTAAAGTTTGGCGGGTTTCCGTAGGTCTCGAGTTCGTGCTTTAGCTTGTTCGCGG
CGGACTGGATCGGCATGCCCGTGCAGTGGAACGCGAACGGGAACACGACGTTCTCGCCTTTGAGTCGGTGGTACCGCGACGCGAACTCGACCTTCGTNNN
NNNNNNNACCGGGAACGTGGCCAGGTACTTGGGCTTGGACGGGTCGGGCTCGGACTCAAACACCTTCGCGGCATCCCACAGCTCGCGCACTCGGTGCTCA
ATCGCGATCAAGTGGTCACGACGCGCAACCTTCTTGGTGGCCGACGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGCACGGCCTG
CAGCTGCGCCTTGACACTTTCCATGGCTGTGAATTGTTTGGATCACTGTTGTTGTCACTGCAGAGCAGATTGTGGATTGATGAGCGTGTTGCTCCTCTTG
CGTAGCTCTTGAGCGTGGCGCTCTCCATGGGCGGATGGCATGCTCTGTTAACATTTAAACCATAGTAGGACAGGCAGAAGTACTGGGCGTAGCCCTTTGA
AGTATGCGCTGCCATCGATCGCCCGCATCTCATCTAATCGCAACGCAATGATGAGCTTCAAGCAGTGATATTGTCCCAGTATTAACACCGCATGAAACAT
ACATATCCTCATTTAATCGCGACAAAATGATGAGGACATTCAGGTCCCACCTATAGATGGAGGACATCCTCTACTTAGGACAATGCTTGCCTATTTTTGT
ACAAAACCATTTAACTTAGGACAAGTGGGGAAAACACGAGCTGCGTTTATATTTTTTTATCCAATCAATATGCATTTGAGTCACATTATTACCTTTCATT
TGCCTAAAATTACGTTTGCTGTGCACATGATTCGCTAAAAACAAATATGTGTACAAAGTACAGTTGACGCGCATCGTCACGTGCGTTGCGTTGCTACGTA
GCGAGTACTACGAAGGAAGGAAGCATCGAGAAGACGAAGAATAGCAAGAAACATCATGGCGTCTCGGCCGCTGCCCCCAGGACGCCGCGGACGCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGCTCTCGCACCTCCCGCAAGCCGTGATCCTCGAGGCCCCGAGCGAGACTCCCAGCAGCAGCGTCTC
CGCCGCTATGGAGACCAAACCCGTTGTCCCAGAGAGCTACGCTGCGGTACCGCCCACGTCGCCACCACAAGAGATCGCTCCCGAGCCAGTGCAAGAGCAA
CCTGAGCCAGTGGTGATTACGCCACCGGAGCCGCCTATTGCTGTCGCCTCGTCAATTCCCCACGAAGTGAAGCAAGTGCACGAGGAGGAACGCACCAGCG
CGCGCAGTGTGGAGAACGTCGAGAGCGTCTCCTATGCGCGCTCTTCATGGCTCCATACTTCGACTGCTACAAGCGCTTCTGCTGCTGTTAAAAAGCAAGT
TGAAGCGATTTCTGCGCCAGTGATGCAAGTGGCTTCTACGACAGTGGAGCCTGCTGCCGTATTAAAACCTGCTGTTCCTGCTGCGACAAGTCCAGCACCG
CAAGCTATTCCTGCTGTAGCACCACCAGCACCTGCGTCTGTGGCTCAAGACATGGATTTGGGAGAATACCACCCGTTCCACTTGCTTCTCCCCGTGGATG
CAGTCCCTGAAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCATCGACTGCATCTACGACGATTCGGCTGCGGAAATGCAGAAAAACATTATGA
AAGTGGTCAAGAAACTGCTGGGTAGGGACAAGGCCAAGTTGGAGGACTTCAAGATCAATTCGCGCTTGTTTGGCAACAATTTCATGGAAGCGTATGAGTA
CCTGGACTCGCTTGTGAAGGAGTTCAGCGGGGTGCGAGCGCTACAACTCGTGCCGTGTCTGCTGATGATTCAAGACGATTTCATGAAACGAAGTGCGCTG
CTGTTGGCTGCGAGAAACTACCGCATGCGAAACCTGGCGACACTCGAGACACAGTGTCAGCAATCTCGTGCGGCTGCAGCTATCCCCCCGCCAGTTCCAA
GTTCGACACCTGCTTCGACTCACGTGGCGAAGCCTGTAGTCTCCCCTTCACCAGAGATCAAGCAGGAGCATGTACCAGTTCCTTTGGCTACTGCGGTGGA
TAAGCAAGGAACGGGTAGTAAAGCGCACTTTGGTACTGAAGAACGTTCAAATGCGACGACTGAAGCGCTTTACAAGCCAACAGAAGGAGTTGCTGTCAGC
ACCATTGCTCTTCAGAAGCAAGAAAAATCCCCTCTTCACACTGCTGCTACTGCTGCTGATGCCGTCCAAGTCAACGTACTCGTTCGTTCTTCTGGTGAAC
CACAGAAAGAAATCGACACTTCTATTACAGCTCCAGTTCCACATGTCGAAGGCAGTGCCCCAGATACAGAGATTACCGAGGTTGTCGATTCTGAAGCCGT
ATCAGCAGAACGCGATGACGAGGTCCAGGAATCATCTGCAGTAAACACTGTGACTTCTGCTGCCTCACCGGCGCTCGCAGTGGACCTTCAAATATCTGCA
TCAAATGTTGCTGAAGAAACCGTCACCGAAGTGTTCTCTCCTGCGGCTATGAGCGAAGCTAGCGCAAGCGTTGTTGCTGACGCGCCTGTGCTGGCTACTG
CTGAAGCACTTTCTGTCGCCGAGAAACCTGTCGAGTCTGTTTCTCATGTCGTTTCTGTTCAACCAAACGCAAGTAGCGCTGTCAGCTCTGCGACTTCAAC
CGTGCCAACCGAGTCCGGTAGCGCTCATGAGATGTCAAGCAGCGAGAGCTTCGCGGAAGCCGAAAGCCTCTTTGGTGAACGATTCTCGAGCAGCAGCATG
TCGGACTCGGCTGAGAATCTGTTTGGCGAAAGCTTTTCGAGTTCGTCAGCGCCGGTCGCGAACTCAAGTGGCTCGGGATCTGCGTCACCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATTCGCAGTTTTTGTTTGGCTTTGCCAGCGCTGGCGCAGATTCGGACTCGGACTCGGACGACTC
AGGCTTTGAGTCTTCCTAGGTCCCATGTTATCTGTGAATAATTTACCACCATGAGAAGAGAAAAAAGGGAAATCATTGAGAGGTGTTCATTCTTGAA