Description :
From Genome Similarity Track
Location :
Scaffold_353:1649- 4481
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_353-fgenesh-gene-0.0Microtubule-associated protein futsch

Sequence
2832 bases(100 bases per row)
CCGACAGGCGACGCACAGGAACCGGCGCACGTGCAGGAGCCCGAGCAAGGCGCGACCATCATGGAGGGCATGCTCAAGAAGCGCGGCGGCGGCCTGCCGG
TCATGCGCGACCGCTACTGCGTGGCGACGTGGGAGCTGGACCTGGCGCTCAACAAGTACGTGCTGCTGCGGTCGTACAAGTCGCGCGCGGCGTACGACGC
GCACCCGGAGCGGCCCACGAGCGTGCACCAGCTCAAGTGCATCAGCGAGTGGGACGGCAAGACGAGCTTCCACCGCTACGAGCACGCGTTCACGATGGAG
ACGTTCGACAAGAAGCTCTTCCACTGCGTCGCGCCGTCCCAGGACGACAAGGCCAAGTGGGTGGACCTCATGGCCATCCACTCGGCGTTCACGGCCGTGG
CGAGCGCCGCGCCGGCCACCTCGCGCACCATGCGCATCAACTCGATCGGCTCGCTGCAGCCGCTGCGCCGCGCGTCCAGCGTCGACTCGACNNNNNNNNN
NNNNNNNNNNCCACGGGCAGCACTCGCGAGCGCGCGCTCACCAATGGCTCCACGTCCACGGCGGGTGGTCGTCGTCGCGGGTCCACGGCAACGGGACCGC
CGCCCATGAAGCCGCGCGGCGTCAGCGACGTGCTCTCGACCGACTCGGAGGGCACGACGGGGCTCGGCGACGACGGGCTCTTCCGCTCCGACTCGACCGA
CTCGAGCGGCTCGCTCGNNNNNNNNNNNNNNNNNNNTGGGGCAACTACGGCGAGACGCTCGGCACTGCCGCCAAGCGCGACGCGGCCGCCTCCAGAGCGT
CCACGACCGCCGCTGCCACGACGCAGGCCATGATGTCCAAGTACGACGACGTGGACGAGCATCAGCGACAGCATGTGCTGTTGGACCAGGACCTGCTCCG
CGGCCACGCCGACAAGACGTCTATGGCGAGCGACGCCTTCCTGTTCGACGACGCCGGTGGCGCCAGTCGCTTTGGCGCTGTCGTGGTTAAGCCCGCTTCC
GAGGACGGGAGCGACTCGGCGGACGACCTCGTCGACGAGGAGCTGNNNNNNNNNNNNNNNNNNNNNGCGCCTCGAGCGCGAGAAGAGCGAGAAGAGCATG
CGGCGGCGCGCCAAGAAGCTCGAGTCGAACCGCGACCTGTACGCCGAGATGGCAGCCGCGCGGCTCAAGGAGATGCGCAAGGACGCGCGTCACCCGCGCA
AGCAGACTCCGCGCCAGCACTCGCAGTCGCGCCACCAGTCGGCGTACTTTGAGAGCGACGAGGACGACTACATGACACCGAACGAGAGGTCGTTCGCAGC
CGAGTCGGAGGACCGCGAGCGCTCGCTGAGCGACTGCGATATGTTCGGGTGGTCCCCCAAGCAAAAGTCTGTCCCGAAAGACTTCCGCATCGACGACGAC
GACGACGACGACGACTTGGTTCCCGCTGTCCCAACCAAGAAGGAGAAGAAGAGCAAGAGGAAGGAGAAGAGCAACTCGATCTCGCAGGAGGCTGCGCCGT
CCGACGATCTGGTTGCGCATAACGACGATCTGGAAACTTCACGCCAGTACCTCAGCGAGAGTGACGAGGATGACGAGCCGGAAGAAGTCGCTCAAGAGGC
GGCATCACACAAGAAGAAGAGCAAGAAATCCAGAGCGAAGCATGTCCAGCTCGAGGAACCTGCTGCTGTGGATGACACCCCAGTTGAAGTCCCGCAGCCG
GCGCCAATTGAAGTGGAGCAAGATGCTGCTGCAGTCGCTGACGAAGAGCACAAGCTAGCCAAGCAGAAGCGCAAGGAAGAGCGCCGCGCCAAGAAGGAGC
GGCTGCGTCAGAAGGAGGAGGAAGAGGCTGCCGCTGCTGCTGCCGCCGAATTGGNNNNNNNNNNNNNNNNNNATTTGGAGGTGATGCGGGCTCGCGAGGA
GGAGAAGCGCCGTGTCGAGCAGGAGAAGCACGATAAGAAGGAGCGTCGCGAGATGAAGGAGCGCATCAAGCTCGAGAAGGCCAAGCAGCGCCGCGCGGAA
GCAGAGCTGCTGAAGCTTGTAGAGATGAAGAAGGCCGAGGAGGAGCGGCGCGAGCAGGAGAAGCGCGACAAGATGGACAAGAAGAAGGTGAGCAAGCGCC
GCGACAAGTACACGTCGCCGACTGAGCGCATCCACAAGATGGAGGAGAGGCACGCGGCGAGTGGCACCTCGTCGACTCGCTCAGCGGCGAGTGAGGTGTC
GAACGCCCTTGTCGTTGTCGAGGATGCTCCCAAGCCTGCCGCTGCCGCTGCTGTTGCTGCTGCCGTGGCGACGCCGTCAGTACCGGCGGCCCAAGTGGAG
CCTGAGACTGTTTCGACTCCGGAGCCCGTGCAGCAAGTGCCCAAGTCCGCTCCTGTCGCTGTGCCGAGCGCTGCTGCACCAGCGATGGAAGCACCAGTGC
CGATGGCTCCGCAATCGATGCCAGCGTTTGGTGTCGCTCCGCCAGCTTATGTGCCAGGGTACTCTTCGGTGATGCCGCCGCCGAACTTCCCGTACGTGGC
GTACCCGCACATGCCGTACCCGGCTCCGTTCGCCGGCAATTCAGTTCCGGCTCCGAGCAGCTACGGTGTTCCCATTGTGCCGCCGTACCTGCAGCCTCAC
CTCGGCTATGTGGCCGGCGTGCCGAGCATGCCGACGCTGCCGCCGACCTTCCCGGAGGCGCCTCCCATGCAGACGGTGGAGGAGAAGCCCGTGATGATCG
GTCCACAGCTTCCCAATGGCGTCGCCCCATTACCGAGCGACGCTGTTGTTGGTCCACCGCCACCGCCGCCCTCGTCGACAATTCCAGGGCTCCCCGTGCT
GCCCGATCTGCCAGACGTGGTCGAGTTTTGAG