Description :
From Genome Similarity Track
Location :
Scaffold_18:164820- 166198
Sequence
1378 bases(100 bases per row)
TCTTCTATTTGCACAGTAACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAATCTA
GTGTTGGTAGTGATAACTGGATAATACATTGGCCATAACCTACAACCTAGTGAGCTTTTCCTATACACGTGCAGATCCGACAGATTAACCGAATTTACTA
CTTGGTCGGTTACACCCTAGAAGGTCTCAACTCTCAAGATCCCATCACAGGAGGCGGCAAGTACGATGTAAAGGAAACGCAAAGGCAAGGGACACACCCG
CAAGGCAACCCTACGGCCAGATCCACGATCTAGCCCCTGGATCCATAAGCTCGAATAATCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGAT
TTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATTCCACCCT
ACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGGCCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGCTGGATCC
AGCAATCTCGCAGATGTTGCTGATCCCGCTACACCACACTACCGCCGCTGGCGAGGGAAATGGGACATCCAGATCATCTGGATCGAGCTCATCATGAGAG
TTGTCTCCCTCTACCGACTCCATTTCGACGTCTCGTGCTACATGGTCGTGGGGCACTTGGGTTTGTGGCCTGGGCATTCGCATACCTTGTTCGGACAGGA
AACGACTCATCGCAGCTTCGAAGTGTCGTTGTAAGGTGCCTGACGAAGTGTCAGAGGGCACGGTAGGTGTAGTATGGCCTACTGTCGGGGACGGATTCGT
GAGACGATTAGCTGGAATCCGATCCGACGATAATCCAGATGGTTTCTTCCTGGATGTGGCTCGATCCTGGCTGGGTAATATCAGATCACGGGTATGACGT
CCTGGATTTCGTGGCCTCACATTTAAAGGCGTCTGCTGCCCCCGGATCCTTGCTCGCGCTTCCACCATTGACGCCCCGGAGGGATCTAAGGTCATGCGCT
GCGGCTCGGAAGACGTTCTGATCCGTCTTCGGCCGCGGATATGTAGTTGGAGGATGCAGCATGGTTGATCATCGGCGACGACACAGAATGCATGGTCTGT
GGCTTTTCCCCGGTGATGGACTCGACACTGACAAAAAGGTCAGGCGCCGCCGAATATATATATATCCAGGTCTCGCTCGAAGATATCCTCCGCATCGAAC
GCACCGGCCACGATGCTCGAATCTGTAAGCAGGCGTAATAGATCCTTAACTACCATTAGTTTGGTCGACGTCTTCGTT