Description :
From Genome Similarity Track
Location :
Scaffold_16:16481- 19464
Transcript NameFunction/comments
Phyra_76050splicing factor U2af large subunit, putative

Sequence
2983 bases(100 bases per row)
TCGAAAGTTTGAGCTGCAAATGCATCAACTGGTGAAGAAACGCTACCGAGCTAACCGCCAGGGAGAACGCAATGGAGTGAAGAAGTGCTGCGCAATGTGC
ATACAGCTCAAGGATGACATGCGCGCGTGGTCTGCCGTCAAGCGCTGGAGCGCGATCAACCCAGGACACAAAGAGCGGAAGTGTGATACCATCAAGCTTT
TCTTCGAGAAGCTCTTTGAAATGCTGAGCAATCACGCGCAGTGGATGCACGAATGTGAAGCTCTCCGCGAGATTCTACGCGCGACCGAGGAGCTGACTGA
AATGCAGTACCCGCATGACGGCGATGCAGTAGACGTGATTCGTTCTCTACGCCGTGTTGATAGCAACGACGGGGGGCATGCGAGCACTGACACGAACTGC
ACTATTTGCATGTCAAACATGAACACGTTTCCGGAGGAGTCGGCAGACCGCGGGCGAGCATGCGGTGTTGACCTACCGTGTGGGCATCGCTTCCACGACA
CGTGCATTTGCATGTGGCTTCACGCGCGTTTAGACTGCCCCGTGTGCCGCGGGCATATCTCCGCCCCCCATTCTGCGCTCTCATCGTCGCGCCGAATCTC
GTAAGCAAAGTGCGCACATGATATTGACATTCACATTGTTTTTTTACGCGATGGCTGGGTGACTTCCAAAAGTGTCTCGGTAGTGATAGATCTGTGAATA
TATCAACAGAAACATTGGGCTGGGCACAAAACATGGAGTATTGCTGCGTCTTCTGCATAAACCATTCGTGAGCAGGTAGCTATGTAGCTGCCCTATTGTA
CTACTCCAATAAGTGGATAGCTTTTGTGTTGTTCCGAAGCTCCGCGAAATGTAGAGCGTTTTCTCCGAACTGTTACAAGCAAGGTGGCGTTAACAGCAAA
AATGTGTGAGACTAGATGCACCATGCCACTTTGTTAGATAAGTATGAAATGTACATGAGTACCAAGTTCTGGAGAGTGATGTCGGCTCCGTGCTTACGAA
GAAAATCAATTGCCTCTGTTTGGTTCGTTTTGGCAGCAACTATCAACGACGAATGTCCCTGTTCATCAGTAGCGTTAACGTCGGATCCAGCCTCGACCAG
GAGCTGAACCACCTCCAGATTCGCTTGTTCACTGTAGCATGCGTGGTGCAGAGCAGTGGAACCATTCTGTATCACCGACAACAAAGTAGCACGATTATTA
GCACGCGTTATGGATAAAACACAAACTTAATGAGGTACTTCGTAATACATGCCGTACAGAGCTGGAACTTACGACATTCTTGATAGAGGTCTTCGCACCG
GCCTGGATTAAATGAGTGACGCATCCTGGGCTTCCTGCTCGAGATGCATTGTGCAGTGGTGTGTTTCCAAACTAGATAGCCTTGATGTTAGAAAAATAGA
AACGATATGGTTCACCCAGCAACAAAAACAACATGAATCGCTCGTTACCTGGTTCTGCAAGTTGATCAGCTGAGCAGACTCCTCACTTGGTCTCTCGAGA
ACTCTGCTCAGGACAAGTTGCAAAATGGTCGGATCTCCTCTGAAAGCAGCCTCGTGGAGAGGGCTATTGCGGTCCTGTATGCAATTGCGCAGCAGTTAGC
ACGACACTACATGTCCACGTAGACGCAGACAGCATTAAACGTACGGGGGTCTTCAGCACTCCCAATTCCGCTCCAGCGGTCAGCAGAATTTGAACGATCT
CTTGGTGGCCACTAGAAATGGCAGCAAGCAGTGGCGTGGCTCCATACTGCATATTCATCAAAGTTTAAAGCACAACACCGCGTTCTTGGAAATACTAAAT
CTCGTACCGACAGCGAGCAGTGCCAGTTGATGTCCACTTGAGCGTCCTGCACAAGGTCTGTCACCACCTGGGTATCACCATTCTCGCTGGCGCGGAACAG
CTCCTCTGTCTGTCTGGAAACCACTCGGTTCGCACTCATCGTCCTCAGCTAGTGACTCTTGGAAAGCAAGATCCAGCAATTGATATGCACCATGAAAGGT
CGCTCAACTTGCTGCTGCTGGTAGTTGCCAGCATGACATGTATTTATCTACTGTCCTGACAGTTTTATGACGGGAATTGACCAGTAGACATGGCCTTTGT
CTTCCTAACGTCCACCATTTCCGAATTGTCGCGCGACTCCACGATGCCGACTCGAGTCCTGATAGCGCTGCTGGTCATGGCGACAGCTACGCACGTCGCT
GGAACTTGCGATGGCTTCAACCAGCTGCGAATGTTCCTGAACATGAACCAAGGCGGCGTTGCAGACTCGCTCCGGGACTGCGTGGCGCCGCTGCTCTTCG
CTCCCACCAAGTGGCTCCTGACGGACCAAGCGAGTGAGTTCTGCAGCCAAGAAGTCTGTGTACGCGCTGTGGCGCAGCTCAAGAAGATGCCTGCCTGCAC
GTGGGACAGTCAGGTGCCGTCCGGCAGTGACGCCAACACGCTGGCCATCGCGCAGCAGGTCATGCGCGACTGTGGCGGCGCGTAAGCAGCGGCTTCAACT
TGCGAGATTTGATCCCTCTTTAAGCTGTTAATCGAATTTCATGATGTAAACTGTGTGCAACAGTGTCTGTATAATGTTCAAGATTTATTACACAGCCAGA
TAGAAAAGACAACCTCTTTATTCCACTAACTGGTGTACAACATACGACTAAAGTACCGCGGGGCGGCCAGTGGTGGACAAGCAGTAGATCGAGACACTGA
GAGCAGCACTATGGCCGGGCGCGGACGAGAGCTCACGCTGCCCGCGTGGATGAAGAACCAACAGCAGCAGCAACAAGCAGGAGGCCCCGCGCAACCCCCG
CCACCGTCCCGCAGCAGCGCGTACCCTCCCCCTCCCGCGCATCTCCAGATGCCGCCGCCAGCGCAGTTCGCCAACGCACCGGTACAATTTTATACAATTT
CCTTTTGTTGTTTATTATTTACACTTGAACTTATAACATTTGCATTGTTGCAGGAGCCTTCGAACGGCGGCCGACCGCCTGTG