Description :
From Genome Similarity Track
Location :
Scaffold_2:164771- 166482
Transcript NameFunction/comments
Phyci_88973Hypothetical protein

Sequence
1711 bases(100 bases per row)
TGGTTAACATCGCTTTATTGTTTTGGATCAAATAGGAAGGTACATGAGGTCAAAATGCGCTGGTGTCGCCATGACAAAGTGGCCTTCGCGGTCCCGCCGC
CATGCGCCGCGAGGCTAGCGTGCCACCGCTTGAGCGTTGTTCTGGTTACGAGCCGCGTACATTGCCGAGTTCTGCTTGCGGATCGTCTTGAGCTTCCGGT
TCGAGATGAGCATGCCGATGGCCGTCGTCACCATCGTGAAGATCGTCGTCACTGCCGCTACGGCAATCCACGCTGTCGGGCTCAGGCCCACGAAGATCTT
GTCGCCGCCGCTGTCGACGCTGGTGCTCGCCGCGGCACCGGCCGTGGCGCCCGTGGGGATGACGGGGAAGATGTTCAGGCCGCAGTTCACCTTGGCGTCA
GCAACCAGCTTCATGAAGCCGCTGGCGCCCCAGGAGCTGCCGTACGAGTTCTTGAGGATCCAGTAGTCGCCCTCCGTGGAGTCCGTGCCGTATCCCACAA
GCAGCAGGGCGTGGTTCACATCGTCCTTCGAAGACAGGTCGCCGTTGTTCGGGCAGTTGTAGAACCCGCCAGCGTAGTCACCGAACGGGTCCTCCGAGTT
GATCGCGACGGCAATCGGCTGCTTCTCGAGAGCTGAGCGCAGCAAGATCGTGCAGTTGCTGGAAGCCGTACATTCCGCGCCGACAATCTGCTCCCAACCC
GTGATGCTGGCCGCCGTTTCATTCGCACTCACCGAGCACGCCGACGAGGCGTTGTTGGACGACGTGCTGCTCGAGCCAGAGTCGTCGTAGGGCATGGTCA
GCTCCGTCACCAGGCCCCACGAGTTCTGCGCGGCATCGATGAAGGCGCCGTGCGTCATGCCACCGTTGCAGCCGTTGTTCTGCGACTCCCACTTGATCGA
CGTCTCCATCCAAGTGGCTCCATCCACGCCACTGTCCGACGCCCAGCAGTAGTCGAACGTCTGCGTCGTCTCCAGCGTGCTGCACGTCAGGAACTGCTGC
GGCGAGAGCGACACGGCCGCCGACGCGTTCTCCGCGATAACCACAGCAGTCTCGATGGCATCCGCCGCGGCAAAGGCCCAGCAACTGCCGCAGTTCTGCT
GGCTCTTGACGGACGAGCAGACGCTGTAGCCGAACGAGTTGTCCGTGTCGCACCAGTTCCAGTACTCGGAGCTGCCGACGCTCGACACCGTGCTGGTCCC
CGTGGCTGTGCTGCCGCTGGCCTCCGCCACGAGGCGACGGGAGCGCGCCGACTTGATTTCCTGGTCCACGAGCTGCTGCGGCGAGAGTCTGCGCCGCGGC
GACGACGTCAGGTGCCGCTCGTTCACGCCCATGTGGTACGAGAACTCGTGGCCCACGCTCTTGGCGTACATGAGCACGTCTTCGATGTAGGTCATGTGCG
CCTGCAGGTTGCGGCGCAGGGGATCGCGGCCGCCGAAGGACACGAGGTTGCGCTGCACAAACAGCTCCCGCAGGGTCTTCGAGTCGACGACCTCGCCGTT
CTCGCCCGCCCAGAGGCACGGGGACGCGGCCGAGCGCACGGCGGGGCAGTCCACGAGCGCGCCGAGCGAGCGCTCCGTGGTCTGCGCGGCGGAGGCGGCG
ACGGCGGCCGCGGAGAGCGCGAGGAGAGACGCCTGGACGCGCATGTCGGTCGAGCGATTCGAGGGATAATTAGGACTGCGGCCAGCTCCGCTGTCTCTCT
CTCTATGGCAG