Description :
From Genome Similarity Track
Location :
Scaffold_74:164762- 172870
Sequence
8108 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATACCTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTA
CCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGA
TGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCG
GGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTT
CACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTG
CTAAGAGTTGGGTGTACACTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAA
CTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTA
GTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCA
CCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCC
CGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAG
CGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAG
GGAACCAGTAGGGGCGGGGCGCCCTACTGCGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTT
CGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGG
CGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCG
ACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGAT
ATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGTATCGGCTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGC
AGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGGGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGG
AGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAAC
TTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAG
AGGAAGACGTCGGATACGCTTCCTGCGTGAGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGT
GGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACG
GGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGAAGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGG
ATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGA
TAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCT
TTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCCCTGGCTTGGACGAGA
ACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGC
GGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGCTTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGG
CAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGA
CGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCC
ACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGAC
ATCCCGCTCACCGCGGTAAGCACTCCAAGCGACATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCATCGACGTTCAATCGCCTGG
TGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGT
GCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTT
CTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAA
AGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCG
CTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTC
GTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAG
CCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGT
GATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGAAATATACACTTC
GGCTTCGAGTTCCAAGGCGCGGCAAACATAACGGTGCTTCGCGGACCTCCCTTCTAGGCGGCCCGGATATGGGAGTGGGCCCACCATCCCGCGGGTGTCA
ACGTGATCTATATGATCTGGATCGCCTGGGCGTATCGGGACGATGAAGCTGTCGCGCCTATCGTCAAGTTTCTTAAAGCCGGAACGAGCGCGAAGTCCGA
CTTGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGGAGCCCACTGATCCTCCACGGGTGGT
CGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTC
TCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCACAGGGCACTCTTCGG
CTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAAT
TTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTG
TTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGCTCCCTTTACTGGGAACTCGTC
TGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCC
ACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGC
CACCCCAGAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGA
GGCCAGTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACAAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAA
AGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACTGTTAG
CTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCGTCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATG
ACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCG
AGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCA
TACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTG
GCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCG
CTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCA
AGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGTGCCGAGT
ACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGA
AGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCAAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAAT
CTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAG
CGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGA
CAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGTGGGA
CAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGC
GGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTG
GCCGCCCACAATGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCT
TCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCT
CAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTC
GCGAAGTGGAGACTTAGAGGCGGTACGCTTCTCTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGT
TTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCAC
CGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCTTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTC
GGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTG
CTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAG
TGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTT
GACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAG
AGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTAC
ATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATAAGTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTTTAT
GACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTT
CGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATACCTTCCTCTAGCGCAAGGTGCTGTGTGACC
CCGTCACA