Description :
From Genome Similarity Track
Location :
Scaffold_656:16476- 18412
Transcript NameFunction/comments
Phypl_g10111mitochondrial-processing peptidase subunit beta

Sequence
1936 bases(100 bases per row)
TGTAGCCGatccattttttttttattcGTTCGTGCTTCTCCCCTGCGGCAAAGTGGCGTACGGCCCGTCCGCTTTCCCATACAGAAAACTCACCTGGTTA
TCTCGTTTCTCAGCCTCTATGCCTCATTCTCCCTTCTTGACGACGTCGGGATGTAGGGGCGACACGACCCGCTTAGTATCGCAGCCAGTACGAGCGACGA
CGGATGAAGTTGTAGtccggcagctcgtggatAGGGCCCGTAGCAGCCAGGGCGTGCTCCTTGTCGTTGACGACCTCGTCGGCCGTCTTgcggacagcgg
cggcgtccacaGCGTCGATGCGAGCGAAAATCTCGGCGGGGGTCATTCGGCGACCATACGTCAGCATCTGGCGACCGATGTCCTCGCAGATGGGCGACGA
GCCATCCAACTGCATCAGCATGTTGGCCTtcagctgcgtcttggcACGCTCaacctcctcgtcggtcgTCTTGTGCACAAGGCGCACAAGCGCCTCCATG
GTGTACCACGTCAGGTCGTTCAGCTTGTACTTGTCGGCGACAGCGTACACACCGAACAGTCCAGTGTCCTGGTAGCACGTGTTGAAGGACATGTACGAGT
GGGcgagctccttctcagcGACCACCTGGCCCAGCTTGGACGACATGTTCATGCCGGCGCCCGAGGTACGGTCCCAGCTGccgagcagcgtctgcatgAT
CAGCAGGGGGAACGCGTGCTCGCTGGTCCAGCTGAAGCCCTCGAAGGCGATAGCAACGTGGGCCAGAGGCATGCTGTCGTCCTTGACGCGCACGTCGGAG
CCGACGAAGCGCACCGGCTCAAGCGTAGGGGCCACAGCGGGAGTCGTGGGCAGGTCGCCGAACGACTTCTgggccagctccaccagctgcgaGTGGTCCA
CAGCACCGGCGCCGGCAATCACCATGCGCGGGGCCGTGTAGTGCGTGGCGATGTAGTCCTGCAGGTCCGACTTCTTGAGGTTTCGGATCTAGAAATTCAA
AGAGCGAGCGGCAAAATAGTCAGTCAGTCAGGCAGTCACCCAACCTGCCTGCCACGATCCCCCTACACTAAGCTTCTGGGCGACGTACGTTCTCAATGGG
TCCCAGGATGGTGCGGCCGAGGCCGTTGCCCATAAAGGCGGTCTCGTGCAGGCGGTCGAAGACgacctcctcctgctgcttgttgacctcctccatctcg
cgcaGGATgacgtcgcgctcgcgctcgatggcggcctcgtccagcttggaGTTCTGCAGGATGTCGCTGAGGATGTCCATGGCGCGCGGCACGTCCTTCT
TAAATACCTTGGCGTAGTACACGGTCTGCTCGCGGCTCGTGTAGGCGTTGAGGTGGCCGCCCATGttctcgatctcgagctccagctgctgctgcgtgcg
cttGCTCGTGCCCTTGAAGGCCATGTGCTCCAGGAAGTGCGCGGCGCCGTTGTTCTGCGCCGTCTCGTAGCGGGAGCCGGCGCCAATCCACACGCCCACG
GTGGCCGTCTCGCCGTGCGAGCCCTCGGACGCCACGCGCAGGCCGCtgggcagcgtcgtcacCTCAGTGGCCGGCGCGTTGAGGACGTACGACGGGTAGT
TGGAcacggcggccgccaccgacGACTGCGCGCGGGCGAGCGGCTGGCGCACGAGGCTCAGCTTGGACATCATCTCGGTCACTTGTGGGGGGCGCTGTGG
GCTGCGAGCTTCCAGGCTACGAATGGGAGACCACCAGTACCCCACGTTTTGGAGGGGGTGATTTCGATTTTTTGCGAGAAATTCGCAAAAATAGAGATGG
GCGGGTGCAAAGACGCTGGCCAAAATCGCCCCCTTTTGTTCTGGGCCCTCCGAACGCGAACCATACTGAGCGCAGGCTGCGGCGTTGAGGACGAGAATGT
GCGCGGGGAAGCACAGGGTCTATTTTCGAGATAGAA