Description :
From Genome Similarity Track
Location :
Scaffold_4:1647170- 1648954
Transcript NameFunction/comments
Phyin_T30-4PITG_03412Putative uncharacterized protein

Sequence
1784 bases(100 bases per row)
GAAAAACAGAAAGAAACTCCAACGGAAAGGCGAGGGAATACCAAAGGAACACGCACAAAGTATTCTTTTCGCCGACAACCATTGCCGACATAGTGAATAA
GACGAAAGAGGTGCGACTCAGGTACTCCGGTATCAGCTGTCAATTAACCGAGGACGAAAACCTGCTGCGGCAAACATGATAGAACGGGGGCTGTCTTCAC
TAATGGCCATTGCTTCTGATTATTCGGAGGCTCAACTCGTGGTGCTCGTGCTTAGCGTCGTCGTTATAGCCGTCGCGCTGCTATCCTACTTCGTGGTAGC
TCCGGAGTACGAGAAGCACCTGGACAAGCAGTACGCAGCAATGGTGGACGCCTCTTCGGGGCGTCACTTGCAGAACCAAAAAGCGCACGAGCTGCTTCGC
GCACGATTTGATCTGCGTAAGCACAAGTCACTTGGCGCCTGGGACATCGAGTCTGGTTCTAGTGACGACGACGGAATGGTCCACACGAGGCGGCAACGAC
GACACTCACAAATGCGGATACCTCCAGCCAGCGCCTCATCATCGTTAGACATGATCAGTGAAGCGATACAACTCGCTCGGAAGGAGCGTAACGCCCGAAG
ACGTAAAAGCGAAAGCGATGCACTCAAACAAGCCAACATTCAGCGAGCAGACATGTTGCGTCGTCGAGTGCAGCTACGGAAACTTGAAGAGGAGATCGCT
GGCACAGTCAAGGCTAACGAGGAAGCGCAGGCGGCAGCGACGTCTAGCAATCCCAATCCTACTTTAGCTATCATGCGTCGGCTCTCGAACAACGCACTCG
ATCTTAGCGACGGTCGGCTCAAGATGCTGCAGGAGCACCCGGCTGACTGCGTCGAGGAGCTTACGGTTCTCGCTCGAGCTCAATCACCGATGGCTACAAC
ATCTCGAGTGGATGTCTTTGCCAAGGCGAAGGGCAAGATTGAGAGTGGACCGAATCTCCGCGAAGTGAAGCAAGCATTGAAAGTATTGCACGATGTGCTC
AGCTTTTACCTGTCGGTGGATCACCGTGACATGAACAAACTCACGGTGTTTTGCAACTCCCTTCTGCAGCACGACGGTCTCAACCGACTACGTGCATTTG
AGGCATCGCGCGATCAGGATGTGCGGGCACTGTCAAACTCCATTATCGAGAAGGCTGTACCTGCCATTTGGCACTAAGAGTGAGCTTTCTGCTCCTATTA
TCTATTGATACTTTAGGATGAGGCGGGGAATTCTCCTCCGCTTCTAACGTCTGTAGAGCTCCACTACAAGAACATGACCCAGTAACAAGTTAAGTAAAAA
TCTCCAGTCGCTTTAAGATGAACAAATACCGGTAGCGTCTTTATTGCCCTCAGTACACGTAGTATCCCAGCTCACAGCACTCCTTTTTAGTTGACATTTC
GATGACTCACATTTCATGTGTAGGCAACTAGTTTTTTTTCCAATGGAACGACGCCGCAATCTCGCTCAGCGAACTGGACAACACCGTCCTGAGTACGAGG
CGGGAAATGGATCCACCACACAGCAGAACGCTGCCGATAGTGGACGGTGTGAGCTTGGAGTTCCAGAGGATGAGCGTCTTGGGCTGGGAGGGGGGCGCTG
TGCTGTCTGCCACGAACTGTACAAATGCCACGTGGTCACTTAGCAGCAGCGGGCCGCTCTTCCTTATACTGTAGCGCACGGTGGGGATGCGATCTGAACC
GTCAGGCGGCCCCGCCGAGATGATCTGTTCCTCGACTCCCAGCGAGACGATCCGGCGGTGACCCACGAGTCCACGACCTTCGCC