Description :
From Genome Similarity Track
Location :
Scaffold_1319:1647- 5053
Sequence
3406 bases(100 bases per row)
CCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAG
CATTTTTGGATCCGGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGTTATACTCTGCTTCATAGACGGTGAGGCCCTCCGCATAAGTGGATCTGGCC
CTTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGAACGTACAGAT
CCTCGTCTGCCTGTACCGTCGGGATCGGGATCGGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTTGAGG
TGTGATGATCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCCCTAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCC
AAACGTCCTTGTAACCCGGCGGACTTGAACAGCCAAGCTAGCGTAGAGTGTCGAGTCAGGATCCGGACGGATCTTCCCACCAGCAGGTTGTAATTGAGAT
CTAACACGCGCAGGAGCGCGAGTATCCCCTTCTCCACCGCTCCGTAATTCAGTTCATTTGGCTTCAGCGTCCGGCTGACGAAGGTGACTGGATGACAGAT
CCCTTCATGTTCTTGTACCAAGGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGT
GTGGTCGCGATCCTGTTCCTCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGGTTCCGCCTTTTCCGAACTCTGATCCGTCGTCTCTATCCTGA
TGGAATCCTCTTTCCTTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCCCTTCTGGTGTCGTACTACTTGGATCCCTTCGTGGATCCGACATCTC
CAGGGCCAGAGCTTGTTGGATTTTGATCCGGATAGCTGGCGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGTGGCAAACCGTGCG
TAATCCTCGATGAACCGACTGTAGTAATTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAGTCTACTAACGAAGACAGGT
CCTTAGGATTCGCCTCCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGATCTTTACCACACTGATAGAGAGATT
CCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCT
AACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCACCCCTTTCGGGTTCCGGTATTC
GGGTGAATCCATAGAGGGCGTTATCGATCAGACGTTGGTAGATCTGGGGCGCGTTCTTCAATCCAAACGGCATCTGGTTCCATTCGAACAGTCCAAGCGG
TGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAA
TCTTCCAGTAGCTCATTGATTAGAGGCATCGGGATACACCATCAATCGAGTCAGGGCCGTTAACTAACCGGTAATCAATGCACAGACGTATATCCACCCC
GTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGATGTTGAGAAACTGAAGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCTGATAGTTTT
TCTCGGAACTGAGGTTCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAATG
CATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATTTTCTGACGTAACCGATCCACTTCCGCGGGCTCGTTTGCCCCTGGATCCACTTGGATATC
GTCAATCGTGACCTCCTCTGTGGTCAGAGGTACCTCCGGGATTACCGCCAGGCCATCCCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAG
ACTTGTTCGTCTTCCGTCTTCGTCGGATCCACCATTGGATCCAAGCACCGCGACTCTCTTTCACCTGGCAGTCCTTCTGTCTTCGGGGGATCAGATACCC
TGGTATCGGGGAAGTCACCAGTTGGATCCAGTCGATTCTCTAGCGAGTTTAGACCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATGAGGATCC
AGGCACTTTGCCCCATGAAAAGCTAGGATCCACTCTGGGGTCAGCGGGATCTGGCAGTCCGGCTTCAACCTTCTGCGATCCTTCATCCACCGACCCTGCG
TTATCTAGGGACCGACTCTGGAGATCATCCCCGGTCTTGGATCCAACCTCCATCGCTTGGATCTCGATCCGACGATCCCTCTGCAGGATTTTTCGCGGAG
TTGGATATGAAGGCCGACCCACCAAGGGGCCAGTTGGCCCTGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATT
CTGCCATTCTCTGTAACGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCCCCAACCATCGCCCGATCTCCTCACAGTGGTCC
AGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGGATTACTGTAGGCACCCATTTCTCGCCCCGAGTAACCC
ACAGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCCCAGGTTTCTCCAGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTT
CGCTCCGTACAACGGTCGCCGTCCGCTGAGCTGGATTCGCATCTCGTCCGGGAAACACAGTGTCCCATCCGCCAGATCCAACCTTACTCCGGCTGGTACC
ATGAAATCCATTCCGAGGATGGCGGCTTGACCAGCGAGATCTCCAACCCAAATATCGAACAGTATACCAAACAACCTGCCAGCGTGATCTTGATCCGCGT
TCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCT
AGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTAATTGTTGATCTTGCCCCCTACCTAGGCTTGTCTGAACCATTTTTCTGGGGCAT
GGTACT