Description :
From Genome Similarity Track
Location :
Scaffold_83:16467- 19750
Sequence
3283 bases(100 bases per row)
GAACGGCAAAGCTGACAGCTCGACCGTAGAGCGACTTTGACGTAAAACCCATTCTAGTGTTGAATAGCGAGTATAGACATAAATCGTTTTTCCAGCGAGA
AGAGTGTGCGTGATCTTTAGCAGTTGCAGCAATGCCATTCCGCTGGATGGTAGTTCACTTCATTGTCCTTCAACACGCGGCCGCAGAAACGAAAAGGGTG
CAGCTTGTCGTCATGAAGCTAATCAGAGTGCAACTTGTTAAAGTCTGAAGAGCACTGGGCGAGGATAGGAAGCTTGAAGAACACGAAAGAAGTCTGCACT
GCGAAGTGAAGACGACTTACGAAGGAGAAGGAATATTTGGAAGTGAATTTATTTGTGAGTTGTTTAAGCTACCTGATTTATCCTTGTCCTGATTTATATG
TTGTGCACATATAAATCATAAATCATGTATATCATCCAATCATCCTGTGCGTCTAATCATTGGTAAGAACTCACCGTAATTACGCAGGATCGACTTGGAC
AGGTTTACGGTTTCCATGGTAACTAATAATAGTACCTTAACCGTCAACGCACAATACGCCCCCTCAATGCGAACACGCGTGGATGCCAAGCGCTGACGTC
AAGTCCTTGTGACGCGGTCCCGGCAGTCCCTTGGTCATGATGTCTGCCAACATCGCAGTTGTTTCGCAGTGCTCCAACGTGACATCACCTCGTTTGACTT
CATCGCGAATGCGGTGGTACTTGATGTCGATGTGCTTAGCCCGACCATGGTTCACAGGATTCTTCGTCATCTTGATGCACGATTGGTTATCTTCCATGAT
CTTGAGCTCGGGTCCGGACTTGTCCTCTGCGGCATCCAGAGTTTTACATAGTAAGCGATGCACCCACTTGCCTTCTTGAATCGCCAGACTTAGCGCGAAG
TACTCCGCTTCGCTTGTCGATAGCGACACACTTAATTGCTTTTTGCTTCCCCAGCTTATCGGAGCACCCATTAGGATAAACGCATATCCTGAAGTCGACT
TGCGGTCTTCATGAACACCGGCCCAGTCTGCATCTGAGTAGCCGCAGAAGTCCACCTAGTTGTCGGGCTTAAAGCAAATGCCGTGTGACTTGGTTCCTTG
TAGATAACGAATAATCCGCTTGACCGCCATCCAATGCTCGACTTGGGGGTTCTCCATGAAGCGCGAAACGTAGCCCACAGCAAAAGCAATGTCCGGTCTT
GTCGCGGTCATTAGATGCATTAAAGCACCTACTGCCTCACGAAACGGAGCGTTGATCTTGGTTGCTGCGTCGCTTGGTGTGAGCCAAGAACTGATTTCCG
TTGGGCTGATGACGGCCTTGCAGTCACTCATGCCAAAACGCTTGAAAACATCGTCCACGTATCGTCGCTGGCACATTGTCACGTTGCCGTCGATGTTGTC
CACCACCTCGATGCCCAATACGAACGCGCACTTGCCGCTTTCAGTCATCTCAAAACCCATCTTCAATTCACTCTTGGTGCGCGCAATCATTTCAGTCGAG
CTGCCCGTTACCACACGGTGAATCTCCCTGTTACAAGATGAGGGCGAAGCGAAGCGAAGGGAGCGGAGAGACCGAAAGGGGAGACGAAGAGACCGGAGAG
AGCAGAGCGGAAGACACTTGCTCACAAGTTGGAAGATTCGAAAGTGATTTATTATCGGGGCTTGGAAACCACTTACTACATGATCTATATGTGGTGTACA
TATAGATCATGTGAAGCGTCTCATCATCCTACGCGTCTAATCAACTATGGTAATTACCGTAAGAACTACGTCGTAAATACGAAGCTGAGCAGGCGGTTCG
GATTGAACCGGTCACGGTTACCAATACTGGTAGAAAACCGATGACCGTCAACACGCCCCCTCAATACGAACACGCATGAATGACTAGCGCCGTCGTCAGT
TCCTTGTGGCGTGGTCCGTGAAGTCCCTTCGCCATGATGTCCGCTAACATCACCGTAGTCTCGCAGTACTCGAGCTTCACTTCGCCGCGCTTGACCTCAT
CACGGATGTGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAACGTTTCCGTGTAGTCGATGCCATACTTC
TGTTGAACCCTTTGGCAACGAGGCGCGCGTTATACTTCTCGATAGATCCATCCGCTTTACGCTTGATCTTGAAGACCCACTTCGTACCAATGGCGCGTTG
TCCGTTGGGCAGCTTGGCTGCACGAAACACACCGCGAAGTCGCATTGACTCGAGCTCCGCATGAATGGCTTTTCGCCAGTGCACTTGGTCAGGGCCGCTC
ACTGCTGCCTCAAATGTTGACGGCTCCGATAAATCCGCTGCTGTTTCAACGGCATTCGCACTCGCACGCCAAGGCGGAGTTGATTCATCAGAATCCTTCG
TTTCTTCGTCTTCTTCTTGGCGTGACGAGTTGCTGTCCGGCGCGCTTGACTCTTCTAGTCCAGGCCGTTGACGCACTGCACGCGGTCGTGGAGCAGCTGC
ATCTTCATCGTTGAGGCGGCTCTTTCTCTTGCCTGTTTGCTTGTACTCCACCTGACGCGGCTCTTCATCATTGAGGTCAAGTAATTCGAAGTCCAGGTCA
TCGGCATCTTCATCGGTGATCGGCGACGGAAGTCCAAAGGTGGACTCATCAAAGTTGACATCGCGACTGACAACCACCTGCCCCGCCTCGATGTCATAAA
CTCGATACGCCTTAGACACTTCTTCGTAACCCAAAAAGATGCCAGCGCGAGCCTTTGGATCCCACTTGAGTCGATTCTCCTTTGGCGTCAGTATGTACGT
CTGACACCCGAATGCTCGCATGTGCTTGACGCTTGGCAAGACAATTTCAAACGGAGTCTTGTGTACGACCTTAGGTGACGGCAGTCGATTCTTGACGTAG
ATGGCCGTCATCGCTGCTTCAGCCCAGAAACACTTGTCCAGCTTGGCATGATGGAGCATGCTGCGGCCGATCGTGACGATAGT