Description :
From Genome Similarity Track
Location :
Scaffold_2:164651- 166074
Sequence
1423 bases(100 bases per row)
GCGATAATAGGCGCTTCTGGAGTCTCTTGATAGATTCGCGCGAGGGTCTGAGCTGCTCGGGTGCCAGTATCACTGTCGGTAGCAATAGCCACACGCAACA
CCGACGTCATCGCATTGCGACGATGGACAGGATGCGACGCCGCGTGGTTGGATGGAGGGTGGTTGTGCACGAGTCGCCACTTACGCGCACCACACAGACT
TTCATTTGGCAGTTGCAATTCCGCGACGCTGCATTGCGCCTGCGCACGGCGGGTGGCGGAATATAGTGCGTTCGTTTCACTCCATGACGGTCGCACCCGA
ACACCACACGACGGACGTCACCGTACTTATCGCGATAAGTACTAGTGGTAACTAGTCCGTAACCGTGATGTTGCGCATACTCGTTCAACGCTCGTTTAGT
GGACGCCGGAGAGTCGAAGCTATGCGCGTGCAGGCAGGGCATCTCCCACCGTACTTGGCGAGCGCCGAGAGCGGTGCAACCTTCATCGCCTCGAATAGCC
TGGATACAGCGAGGGTTGTCTGGGTCGTTCGGGCTGGCGTAGGCAGGGGCGATCGCAGGGGTGCAGAGGTAGGTTGGAGGCGAGGCTCTGGCGGACATCC
GACAGAAGGTGGGGTGTCGGCCGACGTCCACACCATTTCGAACGGCGCGAGTTGAGATCTTATTTCGCGCAATGCCAAGCACACGGAAGGGTTCTCGTAC
CGAGAACTTGAACCGGGGGGCGCCTGCTGTTGCGGCGCGGGACCGCCTTCGATACGACACGATGCTTGAAAGGTGCGTAGTGCCTCTGGGATGGAGGATG
CCCACGCAAGCTCGAACGCGTCCGTGGAGGGAAGCGGCGTCATGGCAGGTAGTAGGAATGGGGCGGGGGGGGGACAGCTCGGGGGGTTAACCGACGCGAA
AAAGCGTGATTGAATGGCTGAGTTGTAACGGGGTTACACGCACACGTGGCTACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTAGAGGTTTGAAC
ACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCACCACGACGGGTGGTCCATGCACATTTAGGATTCCTATTGGCTGAAAG
CAGCATCTTTTAGCCAATGAGTGACTTGCATGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGCTTAGAATATAACATTTAGAGGAAGTTA
GAAACATATACAAAAATAGCAGTTCTCATATTTTACCAAAACCCGCTACTTGGAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTA
ACTCAAGTAAAAGAAACCTAAGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGACCACTACATGAGTGCTCGGAATCC
GAGTCATGTACAAGCCTATACCA