Description :
From Genome Similarity Track
Location :
Scaffold_425:16461- 18611
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_425-fgenesh-gene-0.2UPF0171 family protein

Sequence
2150 bases(100 bases per row)
ATGAGTAGCCTGCTGGGCATCGCGCTGGTCGTGGACGACATCAACAAGGGCTGCAACCTGGCGTTCCGGTACCCGGCGCCGCCGTCGGCCATGGACCACG
TGTCGTCCTTCCACAAGCTCAGCCCCGCGCTCTTCGCCAAGCTCTTCCGCCCCAAGAACGCGCTCTGCAACCAGAGCTTCGAGCTCGTGATCGACGACCT
GCGCTTCGTGAGCCACCCGGTGCTCGTTACGCTACGCGCGCAGGTGCCGGCATCCGCTGCCGCCCACGGCATAGCTGTTACCAATGCTGGTATCATCGGA
AGTAGTAGCAGTAGTAGTACTGGTGCTACGACGAGCGTCACTGGTGCTGCGACTGGAGCCACTGTCCCCAACGGTGGTAGCGTTACCGCATCAAACACTC
CCGCAACGGGCGGATCAATCGCGACGATCAACGGCGGCACGACCTCTGGCAACCGGAACGAGACGACGATGTTCAACATTATCTTCGCGCTCGAAGAGGA
CCTCTCGCAGCTGGACGAAGAGGACGAGGAGGTCGTGCTGCGGCGCCGCAGGAGTATCACAGCATTCCGCACGGTCGCGGCGCAGCTTGCAAACGGCCTG
TTGCACGAAGAGCTACGCTCGGGGTTTGTCTCCAAGGAGGTGCGCGAGTTGCTGTACATGCGTGACGAGCTGGTGCAGAACGAGCGGCTGGTGAACGCGT
CGAACGGTGGCGGTGGTGGCGGTATCACGGGAGGAGGAGGTGGAGGCGGTGGCGGAGGCGGTGGTGGGGTGGGCAACAGCAGCGGCGCAGTGGGCAACCA
CCATCTCCACCGCAAGGATGGTGGTGGCAACAACTCGGACAACGTGAATGGAGGCGGAGTCGACGTCGACCCACAGACGTTCATCGACGTGGCGCTCGGC
AAGAGCGTGCTCGCGAACGACCTCAAGAGCGTGTTCCACGGACTGGACGAGTCCGGCACGGCGCACGTCGTGATCAACCGCTGGGTCAAGCTCTCGCTCA
CGCTCACCGATTCGATCGCGGTCAAGATGCAGAACCTGCGGCCGTACCACACGCTACTGCTGCTCGCGGACGAGGACAAGATCCTGGACTCGCTGCCAAC
GGACCACTCGCAGCAGCTACGACTGCTCATCGAGGTCGCGAACCCGCTCAAGAGCTTCCAGGAGCTGGCGCTCGAGACGTCGATCCCAATCCACCAACTC
TTCCGGCTCTCGGCGCACCTAGTCTACTGGGGCTTCGGCAAAGTGATCGACACGATCACGCTGCGCAACATCTACCAGGTGAATCCACAGGCCAAACTGC
GCGCACAGTCGGCACTGGCGCTCGAGTTCCGCCGCAAATTTGCGCCGCACGAGCTCAGCGAAGTTCTCTCAAGCTTCTCTGGCTCGCGCTCGATCAGCGA
GTACATGAAGAACCTGTCGAATGCCAAGAAGACCGAGTACATCCACATGCTGGTAGGTTTACATCGTATGAGGCTTGTTTGGCTCTATATTGATACTCAT
CGAGTCTAACTTTTGTGTGTTGCTATGCTCTATAGATTTGGCTGCTGCAACAAAATTTCATCATCCAACTGCATCGCTACGTGTACTTCATGATCCCGAC
CGAGGGCGACCACGCGCCGTCCGAGTACGCGCACCAGGACAGCAACGGGTCGTTCGAGAACAACTCGTACGGCTCGAACCAGTTGTCACATCACCACAGC
CAGATGAGTCACCACAGTCGCAATCACAGTCGCAACAACAGCTTTCTAGGGATCCATCCGCAGACGCCGCCGCTTGGCCTCTTGAGCGACCAGCACCTCC
AGTCGGAGAGCAACTTCTCGCTCCAGTCGTTCATGACCTCAAAGGCATCGTCTATAGTAGCAGCAGCAGCAGTAGCAAAGCCCCAGACCCAATTGCAGCA
ACTGAAGCCACGGCTGCTGCAGGATGCGCCTGCTGCTGTGAATAGCAACCCGTTCGCGCTCTCGGAGCAGGAGCGCGAGTACCTGGACCGCATCGCGACG
ACGAACCCGGTCTACACGCTCTTCAAGCGGCTCTGCATCTACTTCCACGGCCAGTACCACTTGGAGGAGATCATGTGGCGCGAGAATGTCTCGCGCAGCG
AGCTGCGCACCGTACTCAGCACCTACCAGGACATCATTGTCTGTTGTCTG