Description :
From Genome Similarity Track
Location :
Scaffold_76:16461- 32019
Transcript NameFunction/comments
Phypl_g2513mitogen-activated protein kinase, putative
Phypl_g2514hypothetical protein PHYSODRAFT_466741
Phypl_g2515hypothetical protein
Phypl_g2516hypothetical protein PHYSODRAFT_326574
Phypl_g2517U3 small nucleolar RNA-associated protein, putative
Phypl_g2518hypothetical protein
Phypl_g2519conserved hypothetical protein

Sequence
15558 bases(100 bases per row)
CCCCGCGCCTCTTCGACCACAATCTTGAATAGGCCGGGTGCCGTGCCacgccacgcagctcacTCGCCGACTCTCTCCGCCATGACGCCCACGCGCTCCC
CGTCCTCGGCGCCCACGTCGCACTCCGCTCGTCTGCGGCACGTGTCGTCGCCTGTTCCAGCGGGgcccggcagcggcggcgggctgcggacgcagacgct
gctggcgcgcctGTTCCGGCGCAAGGAGCGGTCTCCGCTGACCCCGCGAccgctggcgctcacggcCGGGCGCTCGCGCTAcggggaggaggaggagacc
aaggCGCGCGTGGACTCGCccatgcgcgcgctgctgcgctcgctcagtctgcagcgcagccgcagcaagacggcgcaggaggcgcgcacgccgccgcgcg
agccagtgcaggtgctgctcgagggcgtgctcacggtgctcgtgcagcagcgctactGGCGCTCCAGACCCTGctacttcgtgctggagcagacgctcga
gagcggcggcgcccgcgCGAGGTTCACGCTGAGGCAGTTCCGGTTCCAGCCCGAGAACCGGAAGCCCGGCCGCCTCGTGGCGATCGTGACCCTGTcgcag
gacgacgtggtggtcgaCCTGAGGTCCCACCGACAGGCCAAGCACGcgttggagctgcagctggcgtcGTTGGGCCAACGCACGCAGCTGACAGGGACTG
AAGCGGAGGACAGGGAAGAGGAGAGCGGCTCGCAGGTGCTCCGACtcgcggcggtggacgaACGGACCCATCTCAAGTGGCTACAGACGCTCAACGCGTG
CGTGAGCAAGTTGATGGCACAGGCGGAGACGACACAGCCCCGACTCGGAGACGCGACGGGGTGGGATGCAGTCACGGAGCCGGCAAAGATCGTGCCGATG
TTCGGAGACGAAGGCAGGAGAGCGAGTGTGCTGGTGACGACGGGTCGGGACCGCAACGGCAGCGCAGTCAGCTAtaccagcagcgagtgcagcaacaaca
acaacctCTACGAGACGGACATTCCAGCTGAGGAGATTCGAGCGGCGAGAAAAGAATGTGgagaggaggacgaagacgaatcgaaaccagcagcgcgcga
caTGATACACACAACGGCGCGTGTTGTTCCAGCCAGTACAAATGAAGAGCTGCCAGCGCACGCGGTGGCAGGATACTGCTGCACGCCGGAGTATCGATCA
AGTGAGTCATCGAACTCACAGGGCCCCGACACAGACAATAACGCTGCGGGCGAAAAGGACAGCAACAACCAAGACGACAACCAGGGCGATGATGGTTCCG
AAGAGGATTCTGTCGCTGGAGACATTGCCACTCAAAGTTCTGTGGCGCCATACAAGAGTGCAGTTTTGGCAGGAAGGGGGGTGTCTGCCTACCAAAGCAT
GGGGCTGGAGGACGAGTACACGAAAGCCAGCTCGAGATCGTTAACAGCAGCCGAAAATGGGCGCGGGCGGTTTCCTCGCGCTGCCTTTGGtgcctccacc
accagctccaggttATTCCCGATGCTGCGGCCACAGACACACTCCTTCAACGCAAACGGACAAGTTTTCACCCTGGATACTCGCTACCAACTCGTCAAAC
CGATAGGCAACGGAGCGTACGGCGCTGTGATTGCTGTCAAGGACGTGGTCAACGGGGGCGACAATCTGGCAGTCAAGAAAATCACGAACATTTTCGAAGA
CCTGGTCGACGCGAAGCGAATTTTGCGCGAGGTTCGGCTATTGGGTCacttcaagcacaagaacATCACACGACTGCTAGATCtgtcgcctcctccttct
cggaAACAGTTCGACGATATGTATATTATCACAGAGCTCATGGAGACCGACCTGCACCAGGTTATCTACTCCATGCAGCCGATGTCGGACGACCATGTCA
AGTATTTCTTGTACCAGATGCTTTGCGCAATGCACCACATCCACTCGGCAGGCGTCCTGCACCGTGATATGAAGCCCAGCAACATTTTATTGAACGCAAA
CTGTGACCTCAAAGTGTGCGACTTTGGTCTCGCTCGCGGAGGGGTCGGCGCGTCGGCAGGAGTCCATCAGAAGCTCCCACAGCCTGGCGAGCTGACGGAA
TACGTTGTCACGCGATGGTACCGTGCGCCAGAAATCATGTTGAACTGCCTGCAGTACACGACAGCTGTCGACGTGTGGGCTGTGGGCTGCATCTTCGCAG
AAATGCTCTTGCGCGAGCCACTATTCCCCGGAAACGACTACTTACATCAGCTCAAGCTCATCATCAAATTCCTGGGCACTCCAAAGCAGGAGGACATTGG
TTTCGTGAAGAACACGAAGGCTCTGCGCTTCCTCACCAAACTAGCGATTTCCAAACCGAAGAAATGGCTGGATGCCTTTGCCAGCTGTGGCGCTGAGAAT
GCCGTGAGCCCAGAGGCTATCGATCTATTGAGCAAgatgctgctcttcaaccCGGAGAAGCGCATCTCGGTCGACGCTGCGTTGCGGCACCCGTACTTGG
CTACGTTCTTCGACGAGAGCGACCTTGCTGTCTCGAAGCCTTTTGACTTTTCGTTTGATCTTCCTGACGAGCACTTGTCAAAGGATGCTCTCATCGATCT
GCTCTGCGAAGACATTGAGCAGTTCCACCCACCAGTTCCAGGCTCCGTTACGCCCATGCcgttgagcgccagcgctgccagtCGCTTCTTCCGAATGGGG
ATGACCGCATCCGCAAGTTAAACCAAGCGAACACACGAAGGTAAGAGGGCATTCAAGTAAAATAATTCAACAGTACGAAAGCGTCGTTTTGCTAGAACTT
GGCGAAGGATTCGTGATGCTCCTGGTGTCTTGCCCTGCTACGAGGAGATAAACTGCTACGAACCACCCAAAAAAGTTTGTAGTGCTCGGTCTGAACGCCA
CTGGCGCCTGTCGTGTGGCAAAGGACAGTCGAAAGCGGCGCTTGGAGCTATCGTGGACGTCATGTGTCAACATGGACAGCATGTTATGGAGATATCTCGG
TCGTGCAGTCGTCTCTGGCACGAACAGAGTACGTCATGTTCGTTTCAACGGGGGTTTCAGTGCTCGTTCCAAGCTTGTTCACCAAGCTTGTGCACGACCG
GATGCTGCCTGCCTGTCGAAGTGCGACCAAAGGCGGGAAGTAGTGCGCGGCGCTCTCTGAATTCGAGCTGTTACATGAGCACGCCACTGGATACTTCTTT
CGCCGTGCACGCTGTAAAAATTGGCGTCGAACGCCGGAGCAGATCACCAGTCAAGCGTCACTTTCCCAATTGCCTTGAGCTCAGCACACCTTCGTCCAAG
AATCCTTCACCATGAAGTTCTTCGCTCCCATTTTCGCTGCTTTCACCATGCTGGCAACGCACGTGAGCGCCAACGGCGTCTGCTACGATCCGGATCATGC
TAcagccagcgcctccatgaCCGCTGAGAGCGTCAAGGCGGACATGGCCACCATCAAAAACCACGGCTTTACGACTGTCCGCACGTACATCTCCAAGTTC
GGGGACACGAACATGGGTCTCACAATTGCCAGCACCAACCTCAACCTCACGGTAGCTCTGGGCGTGCCGTACCCTCAATCCGACTACGTGACGCAAATGG
ATGCTGCTCTCACTGCTGCCAACACGGGCGGCGTCGGCTACATCTTTGTGGGCAACGAGAACCTTGCCGGAGCGACCAGTGTGCCCGGTGATATGATCAG
CACCATCAAGAGCATCAAGTCGCTTGTACCGTCGACAGTCAAGGTGGGAACCGTGCAGCGCAACACCGAGGTCATCAACTACTCTGGGATCTCTGGCTGG
TCGGATCTCGTCGCTTCTTGCGACGTGTTGGGCGTGAACGTCCACCCGTACTTCACCCCCGGAACAaccgccgccggcgccatCGACGTCGTTAAGAACC
AGTGGGAGGTCATGCAGAAGAACTTCGGTGACAAGCTCATGGTCACGGAGACGGGCTGGCCTTCGGACGGCACCCTATCGGGCAACACTGGCAGCACGGA
AGGCCTCAAGACATTCTACAGTGACTACCagacgtggagcagctcgatgggCGAGTCCTTCTTCTTTCAGATGTTTGACACGCCCCACAAGACCACCGCG
TTCGAGAAATCGTACGGCTTGCTTACGTACGACTCGAACGACAAGTTCACCGTTGCTACCGCGGAAGCCGCCGGCACGGTGGGTCCTCAGCGCTTGCGCT
AGTGAGAGTGCCACAATTCTTGTCAGGAAGGTTTCAACGTTTATAGAGTACTTGAGTCGTTCTGAAAGACTACCGACACCCGCGATAACAGCCACAATCA
CACTACGTGCACAACCATTTTCTTACTAAAACTTTGCTTGTCCGTTCGGTCCGCTACGACTTGGGCGAACCGAAGCCGCAATCCGCGAGAAATTGTTTCG
TATCGTCACGAATGGAGAAGCCTGAGCGCAGGTTGCACTGGATGCTCGAGTCCAAGGACACGATGTGGTGATACCAATAGGACGGAAGGTACAACACCTC
GCCGGCAGTGAGCGCCACTTCCGCCGCCGGGCAGTTGCGCGCTTCCTCCGACAGAGCACTCGTGTCCGACCAATTGAATGACGTGTGGCGCGCTGACTGG
CCCTTGGTCCTGAGCCCCTGGCACTTGCAAGCACTCGGTGGTGCGATCACATAGCGCTTGGTTCCTCGAATCATGGAGATATGGTTCAAGCCTCCATCAA
TGTGACCCTCGGCAATAATGCCTTCCATTCCGAGACGACAGCGCATCCCGCGCTCGCGGGCTAGTGCAGCATCACGAATGAACAAATCCCCGAATCGTGG
GTCGTGCTCGGTTAGCGTTGGGTtcaggaactgcagctcgtcgtagaTGAACGCCGCCTGCTTCGAGAAatcgctcttcttgagcatcAAGTAGTAGTAC
TCGTGAGGCTTACCGTCCTTTTCGAGCGGCTCGACGTCGTTGATAGCCTTCACAAACTGCGGATACGTCATCCACCGAGACTCGTACGTATCCTTCTCGC
CAGCAAgctgcttgctcttgagGTAGTACATAAAGTGGCTGTCGTTCGCCACATGCACCTTGTACAGCGCCTTCGGACTCAGCTGCTCCGTCAAGTACTC
GTCCGTCCACCGCTCCGTAGCTGCCGTGAGCTCTGGGATCCCGTAAGCTACAAACGGCACCTCCATCTCCCGAAACACCTGAGCCAACCGAAACTCATTC
TGTAACAAAGACAGCGTCAGTCTCCCACTTAACCAGCACaggcaccaccaccaattACGCTGTTCCGCACCAGGTCGGAGACGTTAAAGTGGCAGATgct
gtcgaagatggcgtgCGGCACTTGCGCGGTGCTTTCTGGCCTCCAATTGTCAAACAATGCCGCAGACGGGAACAACTGCGGGTAAGCTTTGCACCCCTCG
TCTCCGTCCAAGTGGCACTGGAaccgcagcgacggcaggtCGCACTGGAATTTGTTGGCGGCTCCGTTCGGGTACTGAAGAGGCAGAAATCGCTGCAACC
TTTGGCCCTTTAACATAACGACGTCGTTGCCAGCCCCCCAACGCAAAGCGTTCGCGTCACCGCTCGCGTGGAATTTCGTCCGGAGGTTTGACGACAGTTT
GGAGGTCAGTGCCGCCATTTCGGACGGGGGGGAGACCCAGAGTCCCAAACTCAGAACCCCCAatccgagcagcagcagagcaacagcagccccaCCGCAT
TGGCCCTGACGCAGTTCCCATGCGCCGCGACGCAGGAAGGCCGTGGCGCGGAGATGAGCGACAGCCCCCGATTTGGTCATCAGTCGTGGCGTCGACACAG
GGGGAAAATGATCAAATGAACTGCCCCAAAATCTGAATACCTATGAGTTTCGGCGGTAATGGCGTTGTGCCTGTGGATGGATGCAGGTTGACATGCAGGG
ATGGCTGTCACTTATTGATAGGAAAGCACGCTCTGCGTAGAGAGATGGTTGCATACGTCCCCGTTGAGGTCGACCTAATTGATGTGTACGACCGTTCAAG
GCATTCGAAATACATGTGTCCCAACGAAATATTGtcgtgttggtggtgctAGGAGTAAGCGAGAAACCCACAGCAGGTTGGGTAGCTGCGGTTGGAATGC
GAATCAACTGAGTGGCGACTTCTGTGCGGAGGAGGCAGGCGCCAGCACGAGTTGTTGTTCGCCGTTGATTATGTAGGACTCTCTCGGTCTAATAGCTGAT
TATGTAGTGCGTTTGCTGTGGTTGGGCGGTCGTGCCACTGCTGGGCTATCAACGAGTCGCTGAGCTGAGCGATCTTCACTCACGGGGGGATCTCACCAAC
AATAAGCTTACAGTCTTCGGTTGCCTGTTTGTCGACAGAATTGTCTCCGTCATCTCGCTATTATAGAGGTGGCAACTGATTGCATCATTGCTGCTCTAAC
GTCATCGTGCTGGTTAATCTAACAAAGGCAACACACTCGTCGTAGCCTGCCATTCTGCCAGCAAACAGGTTGCACAGTTCCCAAATCGCCTCCAAAGACC
GAAGCAACAGCCGAATCCTTGCAGTGTCATCGCTTTGCCGTCATGGAGTTCACTAGCGCCGATCCTGAGTCTGGACCACCCGCCAGCGAAAGTCAAGTCT
TCTACGAGTCCGTCGCAAGCAAATTCGAGACTGCGTTTGGGGGGCCTCACCCGAAACTGGAAGTCCGCTTCTCGGATTTGACGGTGTCGTGTAAAGTGGC
CACATCgcagcaagacgacgacgcgtctCCGGAGCTACCGACAATCTGGAACACGCTCAAGCATGCGGCCCAAAATCTCGTTTCGGTACGGAACACGGAG
CAGCGCGCTATTCTCAAGGGGGTGAGCGGTGTTTTGCGTCCCGGAACCCTGACGCTGGTGCTTGGGCAACCAGGATCAGGGAAGTCAACGCTCCTCAAGG
CTTTGAGCGGGAGGCTGCACACGAACGGTGGCCATTTGAGCATGACGGGCGAGATAGCGTACAACGGCGAGCTTCAGCATGCAATTGCCAAGCAACTGCC
TCAGCTTGCAACGTACGTGCCCCAAAAGGACGACCACTTCCCGCTCCTATCGATCCAAGAGACGTTATCTTTTGCGCACGCCTTCAGTGCCGGTAGTGGC
AACGACGTCGCTCAACACACTTCCACCTTGCTTGGGCAAAGTGCTGGCCATGACAGTCAGAAGGCACTCAAGGGAGCTATTGACATGTTTGAAAACTACC
CCGAGGTCATCAAGGCGCAACTTGGATTGCACAACTGCTGGAATACCGTTGTCGGAGACAACATGGTGGGTGGCGTGTCCGGTGGAGAGAAGAAGCGAGT
GACGACCGGTGAGATGGTTCTCGGTATGCAGCGTGCGGTATTCATGGATGAAATCAGCACGGGACTTGACAGCGCTGCAACCTTCGACATCATCAGCACG
CAGCGTACCATCGCGCGAGCGCTAGGCAAAACCGTGGTCATCTCGTTACTGCAGCCATCTCCCGATGTGGTCGCACTCTTTGACGACGTCATTCTCCTGA
ACGAAGGCGAAGTGATGTATTACGGTCCTTGTGACAAAAACTTGTCGAGTACTTCCGCGAGGTGGGCCTCCAGTGCCCTCCCAATCGAGACGTCGCCGAT
TTCTTGCTTGACCTTGGAACTCCGCAGCAATGTGCGTACGAATCCACGACGCTCGCAGGCGGGAAATCTCCTCGCCAAGCGAGTGAGTATGCGGAAATGT
TTCGCTCGTCCGACACCCACCTGGGCCATCTTGACCTTTTGGAGGCGAATCTCGACCACAGCAACCTACATTAAGTCCATGCCGCAATTCCAGCGATCTG
TGTGGACAAACCTGCTCACGCTTGTGCTGCGACAGCTTTTGCTCCTCGTGCGTGATGCGAATACGCTTCGTAGCCACCTTATCCTGGTTTTAGTGGTGGC
AGTGGTGAGCTCGACTGCCTTCCTGGACGCGGATCCCACCAACGTGCCCTTGCTGCTCGGAGTGCTCTTTCAGGCAGCGATGTTCCCTCTCTTCGAACAG
ACCTCCCTGCTTTCCATGTTCGTCGACATGCGCGATGTATTTTAcaagcagcgagaagcaaACTTCTTCCAGACGTCGGCGTACGTGCTCGCCAACGTCG
CCAGCCAAGTGCCGATAGCGCTGCCAGAGAGTTTCGTTTATGGCGCTTTCGTGTATTGGATTGCTGGACTTGAGGCAGACATTGGAGCCTTCCTTCTGTT
CGAGTTGATCGTCTTCCTCACGGTGATGGCGGCCATtctcatcttcttcttcgttgtcgaGATTTCCCCGAACATCTACATCACGAACCCGCTCGCTTTG
GGAATTCTCCAAGTGGTGCTCGTGTTTGCCGGGTTTATGGTCACCAGAAGTCAAATTCCAGACTACCTCATTTGGCTTTGCTGGATCGACCCGATGGCGT
GGGCTTTCCGGGCACTTGCCGTGAACCAGTACAGATCTGCAACGTTTGACGTGTGCATCTACGAGGGAGTCAACTACTGTGATGAATTTGGCAAAACCAT
GGGCGAGTATTATCTTGGTGTGTACGGCATTCCATCGGTGAAGGAGTGGGTGGTCTTTGGGATCGTCTACCTCATCGGGTTGATCCTCTTGTTCGCGGTG
TTAAGCTATTTTGCCCTCGAGTACAAGCGATACGAAGGTAATTTCAGGGCTGTCAAACTGGCAGTAAGGGGTGATGATGAATCTGGGAACTATTCTCTTG
CCACGACCCCCAAGGACGGTAAGCAGACTACCCCGTTCAACTCAACGGACAGGTTTGTGTCGATCGATGTTCGTGGACAAGCAGTTGGGTTCGTGCCGGT
CACCGTGGCGTTCAAGGATTTGTGGTATTCGGTGCCAAACCCAAGCAAACCGACCGAGTCCATTGACTTGCTGAAGGGAATCAGTGGCGTCGCTCGACCA
GGGACAATTACTACACTGATGGGCTCGTCCGGTGCTGGCAAGACCACTCTCATGGACGTTATCGCAGGCCAAGAACACCGGGTCTGTCCGAGGCAAGATC
ATGCTCAATGGCCACGAAGCTACGGAACTCGCCATTCGGAGGTGCACTGGATATTGCGAGCAGACCGATATTCACTCCGACACCGCGACGTTCCGCGAGG
CGCTCACTTTTAGTGCCTTTCTTCGTCAGGATAGTGGTGTCCCTGCGAGTGCCAAGACCAACTCGGTGGATGAAATCGTGAGTTTGTTGGGCCTTGAAGA
CATCGCTGATCACATGGTGCGTGGGAGCTCtttggagcagctcaagagaCTGACGATTGGTGTGGAGCTGGCTGCCCAGCCCAGTGTGCTGTTTCTCGAC
GAGCCAACAAGCGGCCTGGACGCACGTTTCGCTAAGCTTGTCATGGATGGTATCCGCAAGGGTGCAAATGCCGGGCGGACAATCATCTGCACGATCCATC
AGCCATCGTACGAAGTGTTCGTTGTTttcgaccagctcctcctgctgaAGCGTGGCGGCGAGACTGTGTTCTACGGCGAGCTTGGCACAGATTGTCGAAC
GTTGATCGACCACTTTGAGGCGATTCCCGAAGTGCAGCCGCTGCGTCAGGAGTACAATTGTGCCGCGTGGATGCTCGAGTGTATTGGCGCGGGTGTCAAC
AAGAAGGCACCGCAAGGTCACGATACGGAATTCGTCCAGCGTTTCAACGAGAGTGCCTTCAAGGCACAACTAGGCGCTGAGTTGGGGGAAGGAGGTGTCG
GACGACCTTCACCTCGTGTTCCAGCTCTTGTATTCGGTCGAAagcgcgcggcgtcgtcgatggtgcAACTGAAATTCCTGACCCAGCGCTTCTTTAACAT
GTACTGGCGTTCTCCAGCACACTACATCACGATCCTCGGGGTGGCTCTTGGGAGTGTTCTCGTGCTGGGCCTTATCGGCAGCAGTTTGTCGGTGACTTCG
TACCAAGGAGTTGCCTCCGGGCTCGGGATCATCTTCGTCGCGTTCCAGTTCCAAGGGTTCGTGTCCTTCAACAGCGCGATTCCGTTCGCTTTCAGCGACC
GTGCAGCGTTCTACCGAGAGCGCTCGGCGCAAACGTACAGCGCGTTGTGGTACTTTGTGGCAGGAACGATCGTGGAGATCCCGTACGTCGTGACGAAAGG
TTTGATCATCGCGGCGcttctcttcctcttcatgGGCTTCACGGGCTTTGCCAAGTTCCTTTTGTTCTGGCTGGGCGTGTCGCTGTCCGTTCTGATAGAC
GTCTACGCTGGGCACCTCCTGGCCTTCGCGCTCCCCAACGTCGTCATGGCAGCGCTCGCGGGGTCCGTCGTGTccaccatcttcttcctcttcgtcggct
tcaATCCGCAAGGCGGCTCCATCTCGGCCGGCTACCAGTGGCTGTACACGATCACGCCGCAGCGCTACGCCATGTCGATCCTCGCCGCGTTGGTGTACGG
TGACTGCTCCACGAACCCTGACCTGGACACAGCAAGCGGCGAGTACACTAACGTCGGCCCGGAGATCGGCTGCCAGCCGCTGGTCGACGCGCCCGTGTCG
ATCGGCAACGTGACCGTGAAGGGGCTGGTGGAAAACGTCTACAACATGcaccacgacgacaaggcgCGCAACTTTGGTGcgctcctcgtcttcgtcgtgg
tCTTCcgagcgctggcgctgctggcgctgcagttcctcaACCACCAGAAGAGGTAGGTCATAACAACTTCAACATAACCTTCAATTCACTTAAATCAGTT
CCCTTTGTGGCCCACGTGTATGTACCGATAACATGGTACACTTCATTTTGTCCGCCTTCCTCGTTGCCAGCCATTCCTGTTTTTGACATCAACTAGGGGA
GCTTAGCGGTTAGAGGTTAGTTTATGCccatgtcgtcgctgcgcaaCGTGGTAAAGCGGCGCGAGCACAAGGAGCGCGggcagctgcgcgagcggcGGAA
GCTCGGCCTCCTGGAGAAGCACAAGGACTATGtgaagcgcgcgcgcgactacaacagcaagcagcagcggctcacgacgctgcggctcaaggcggcgctg
cgcaacCCGGACGAGTTCTACCATCGCATGCGCGGGGCCACGACGGAGGGCGGCGTGCACGTGTCCACGCACAACCACCGCCAGGCGGCGGacacggagg
cgctgcgctcgctcaagacgcaggacTTGGCCTACTTGCACATGAAGCGCGCCGTGGACCTGTgcaaggccgagaagctcaaccGCGGCCTGCACTTCGT
GGACGCCCCCAAGAGCAACAGGCACACGGTGTTCGTGGacggagagcagcagctcgagagctTCGACGTGGCGCGGCACTTCGACACGGCCCCGGAGCTC
GCGGACCGGGCGTTCAACCGCATCCGCAAGCGCGACCTCGAGACGGCGCGGCTGCCCGATCTGGCGGCGAAccccaagcagaagcacaAGATGCAGGTGG
AGAGGGACGCCATGTACAGAGAGCTGCGGGACAGGCTGGCGCGCGCCCAGAAGATCGGGCAGAGgagcgccaagctggactTGGAGCGCAAGGTGCAAgc
caagggcaagaagatgaaggtcaaggcggcggagaacGGCATGCCCGCGGTCTAtcgctggaagcagcagcgacagaaGTAGAGAGCAAGCAGGCGGGGC
AGGTGACGACGGTGAGTGGACTGGAGCCTTTGCATTCATAACAAGCATTTTTTTAGTTGAGGAAGGAGGTTTTTGGTGAGGTTATGCTGCCGAGGAGAGC
GGAGTCTTAGGTCGCCGACGGGgagcgtggtggtggtgtccGTACGCCTTGCGGAtctggacgagaagctgtAGGATCACGTCGCGGTTGCTCGCGTGGA
TGGCGTTCGCACGacgcagcaggtggagagGCATGGTCTGGGCAAAGGAGGGAAGCGTGTTAGTGAGCAAggaaggcgctggcgacAGATCAAACGAGAA
GGGCGATCTaccttcttctgctgcagaatGTTGAGCGCCTTGGTGATGTTgtgcagcgcgctggctTTGCTTAGCGGCTGCTTGCCGGTTGGTCGCGTGA
TGCCTGGGAGGCTACGCATGAGCTCCACCTTTTCGACGATGCAACACAACAGGATGCCGGACTGGAATTCCGTCAAACTAGCAGTCGAGTCCTGGTAAGC
AGCAACATGGAAAAAGTTATGTGAGTTTCAAGTGATGAGTATCAGCTCACAAATTCATGTCGTACGTGAAAAGCGGAGGCGTTCTTGAGGCGAACGCCCA
AACGTTTCAACCAGTGTAAGATTTCCTCGACAGGTTCTCGTGCTAACGATGCGTTTAGCTGTGCTTGGCTTGTGAAAGGTTTGACCGGAGAAGATGCTCC
TGCTTTAGTGGCATTGCCATCATTACCTTGTTCCGCCAGCTCGATTGGGTCGGCAATCGAGGTTACAACTGCAGCTGTACAAGATTGCTCGCGATACTCG
GATTGCGATGGGTGTTCTTGTATGACAAGCTCACCTGACAATTCTCCTATCGCAATTCTTGGGGGAATTTTACGATCAAGACTCGAGTTTTCAGCAAAAT
CGCTCCCATCTGGACGAATAGGCAGGAGGTCGTCCACAACACTGTGGCTGGTACCGCTCTCGTGAGCCTTCATTGAAAGAGGATCGAAATAATCGTTGTA
AACTGGACTGGAAAAAGGTGCTTTCGGGACCGGAAAcacgtcgtcatcgtcgtaATTGCCGCTGGGATCATTCTCGCTCCATGCAAGACGACGGACAAAA
GTGTCGTGGAGTTTAACCTGGTATGATGTTACGAGATCATCTCGAACCGCAAGTTTTCCCTGACCAGCTAAAGCAATGGCCGGAATATCGAGCAGTAGCG
GAGAGGGCTGAACTGGAGCCGATAGTTTCCCAGCAAGCTCGACTTCTTCTGCAATCCTCGTGTCGTGGCAATTGCTCGGCGGGGGTTCAACACCCTCCGT
AGCTTTTTCCGATGAAAATGTTGTTTGACTCGCCTGCCAGAGATACCACAAAATCCCGTACGCAACTTGTCGGTCTCCGATGAGTACCGATTGTTCAGCA
GATGTAGTCATGTAGCAGGGGGGGACATGATTTCCTAGTCTTTCGAACGCCTTTGAAATGTTTTCTCTGGACACAGGAAGAGACAAAGTCGGTCGATGAA
AGCCTATCAGCAAAGATCCCACAAACAACAAACCTCATCTCGGTTAAAGTTCGGGGATTCTTGAAATACGAGAACGGTGCGCTCTTCATTTCCTGCATTA
ACAACGCGCTGCGAATATCGACAGCAGACAGCGTCATAcatgcagacgcagcagttTACCTTCAGCATTTCAACAAGGTCACAAAGGGGAACGACAATGA
GCTTACCAGAGCAAAACCCCGTTGCGCATTGGGTCCTGAAGTACCCCACGACCGGAAACCTACGCGAAAAGCATATAAGTCATCTCGTTCATGAACATCG
CTAACCGTATACTGAAATCACCTTCTTCGCATCGAATCCGACGTCGACCAGCCACTCGTTCACCACGTGCATCTGCTCACCCGTGATATAAGGCAAGCTC
CGCTTTAATGGAGCACACCCAGTGTGTTCAGTTTCCGTAGTGATGGTCTTCTTTCTTCTGTTTTGAGGCGAGTGGAGGTGTTTCGGGCTGACGGCAAATT
GCCCTTCGCCATGGTTAGCGTTTTTTTTCTTACGACCTACAGTCGGAAAAGTTTCGGGGACTGCATCCACACCAGATTCTCCAGTGTTTTGGGCATTTGG
AGCGGAAACAGCACGAGGGAGTCGTTCAACACTGGTCAGTACCTCATCTAACGCCCACCAAATCGATTTGGGTGAGACTTGTTTTTCTTGTCGCTGCAAG
GACTCGAGCGAGTTCAGAGCCTCCGATGAGATTCCGAGGCTTTTGAAAGTGGAGAGAGTTAGCATAAAGTTGCGTCGCCTCCCTGCCGGGGTATTCACGG
CTCCAAATTCGTCGAAATTCATGTCTGTAGCTTTGAAAGTGCTACAGTTAAGTTGCCCACCACAGCGGTGAACAATAGCACCAGCGATACGATGAAGCAG
GACGCCGTTCGCGAATAGTTGTCGAACTTTCCTTGGCAACTGTAATCTCCAGCCCTCCAATTGCTTGGTGAAAATCTGCTCCAGGGGCATGTCGACCTGC
AAGACAAGTCTAGCCCAGTTGCAAACACGAACTGCACGCGCATCTTCGCTGTCAGGACCTTCAACAcacttgctgcttgaaggCTCAGTGCTAGACGGAT
ATTTCGCGATTGGATCGAGCATACTAAACACTCGAAggccgctgtcgtcgtgaAAAATGCTAGGCTGGTCCgattttttcttcttgtcgatAGCAATTGG
TGCAATTGGTGCAGTACCGGAAGTCGGCCCAGTTCCAAGTCTTCTTTTTGCTCCAGTTGTCGGCTTCTTTTTGCTTTGCTTTTTTTCTTTGAGTTTGTGT
TGTGGGGCACCTGCTTTCCGAGCATCTTTGGAAGGCTTGGCCGTGTTCACACGGGCTCGTGATCGAGACGAAGACGTTTGTACTCGCTTGGGCTTTTGCT
CACCCCCTCTGGTCACCTTCTCAGTTGGATTCTCTGGTTGCAGGGAGTGCTCGATAATTTTTTCTTgttcacgacgacgacgcagtgCGGCCTTATGACT
CTCAGACGACTGATGCTCCTGCATGCGTTGGACGCTTAGGCGCTTCAAGACCGTGAGCACTGCGCAGAGAGCGTCACTTTCGCCCGACATCACTCGTGCT
AAGCAATCGGCATCGTTGACAATGTACATGGCTTCCTCATCCCGACTTCGACACTCGCTCGCTGTGAACTGGACAACACGACGGAGACGTTCCAGGATCT
CGCCAGTACTAAACGCCTCGCTGTCTGATACTCCGTCGCCTGTAGCAGCAGTCCCTGCGTCAGCTGAATTGTCCTTCACAGTCTAAAAACAACATTAGTG
GCGAGCCCCACAACCGCTGCACAGCTAGTTACATACCtgaagccactgcaccatTTCGTGCAGCACATCACCGAAGCGCAAGtcacgcagctcctcgacc
aGCAAACACTTGGTGAGTGGCAGCGAGTTGACCCAGTGCAGCAGTAGTCGCTGTCGCACCGAGCCATTCgtctcttcatcgtcgatAGGTGCGGTGACAA
CCGAAAGCTCCATCGTTCATGAACCTGGAAATCCTCACCGCGACTCCAGCCTTCCTACTATCCGATACGTCGATCTTGAAGAGTCACAGGCCCGAAAACT
GCCGACACCAGTGGTCGATGATGACGGGCACATCTACGGATTTTTTTTAACGTGCTACAGACAGTAGCATGCCTTACCGTAGCCTACAGTGTGTACCTGT
GCTGTACTTTTCGCTCGACTTGAAGACGCATTCCTGACAGGGATACTGTTGAATCCCGCGTGTACGACGCAGTTTCCGAGACCCACCCGAGTCGGTCTGC
CAGAGCCGGacggcgagcacgagcttTGCTGTTTGAAAGGTCCGATCGCCATTGACGATTCGCCAAGAGCTCTGGCGTGTTTGCCGGCAGCACTAGCAAA
TCCCATTCCATAAACAGAACGGAGAGAAACTCGGGTCACGGCCATGACAGCCTCGCtc