Description :
From Genome Similarity Track
Location :
Scaffold_11:1646089- 1654179
Transcript NameFunction/comments
Phyin_T30-4PITG_07541Putative uncharacterized protein
Phyin_T30-4PITG_07542Putative uncharacterized protein
Phyin_T30-4PITG_07543Putative uncharacterized protein

Sequence
8090 bases(100 bases per row)
TCATTTCTCTGCATACAAACTGAATGATATTGCGGCACAACATTTAGTGTTGAAGTGACGAGTCGAGTGCGGAATGGAGGAAGCTTTCTGCGCGGAGCAA
AGCGTGCATTTACACACAAGCGTCGCGGAGGGCGTCACGGAGAGCGTCGCGGAGGGTGTGATGCCGATGGCCATTGACTCTGGTGCGTCTAATCGTCGTG
ATCCTACTCGATGCTTGCTTTAACTGGGATGATGCCGTCATTGTGCTAGAAAACAGCAACTATGAAGCAAATACAACGCTGGCAAGGGAACTAGGGGCTG
TCCTGGGGTGTACGGATTCCGACAAGGAAGACATACCACTTTTGTTCAGCATAGATGGTGGTGGCGAGAGAAGATTGTCGAGTAGCTCATCAACACGGAG
CCAACTCGCAGACTACAGTGCCTCTCGCTACGCTGGAATGACACAGCTGCGTGGAGATTTTGATGAAGCTGCTGATGGCATGGACGACGAGGAAGGAGAC
CATTTCGTTGACCTGAAATGTGTGGACCGTGGCTTCCCACTTTGCACGCATCATCTTCGTGTCTGCTGTCGACACTGCAGATTTCTTCAGCACACGCGGG
TATTTGTAGCGAGTCTCGATTGCTAGCGCTGTCAGCGCGACCGTCCAGCGCATTGGTGGGGCTGAGGTCTTAGATTTCTTCGGAGCGGATGTCTTCTTAG
CAGGAGCGCTCTTCTTGGGAGCTGCCTTCTTCGTCTTCTTGTGGGCGGTCTTCTTCTTGGAAACAGCCTTCTTCTTGGTCGGGATGCTCGTATGTGATGC
TCTCACGTTAACTTGATCGGAGGCCAGTCGAGCTTTCTTTGTCGGTGGGGCTTCAGTAGCTTCGCTTGACGATTGCTGAGAGTCTTCCCCGGAGGCTTCA
GACCACAGCACTGGATCCATTTCCTTCCCACGGATCACCACGAGGCTTTCAGATAAGCCTGCAATTGGAGGGGTCTCTTCACTTGCCAAAGCGTTGCTGC
ACTCCTGCGTAGACATAGCGTGCTCCAGCTGGCCGTCTTCTTTCAGCAATGCGCGTGCGGAATTGAAGTGCAAGGGAAACAACCTATCAAAATGATTGTA
TGAATTGAAATAGGTTTGGTGGAATAAATTTGGCGGAGCCAATTTCTCATTTGGACATGCGACGATTTATTTGGCCTCATTTTTTCTTCGCAGAAAAAAA
GTTGTCGGGGGAAAATTAATCACTTTTTCTATTCGGACAGCGCTCTAAGTGAAGTGAATCTTAAGCGACAAAACTGAAGCAAACACGTTCTTGTGGCAGC
AAATGGCTGGCCACTATTCCCTCGACGAAGCGCCGCCTGTCAAAACATCAGTTTGCATTCAGCTTTGGGTCTTCGCATTCAGGCACGAGACAGGGCAAGC
AAAGCCGACGCAAGACCGAAAAGAGGCGTTAATTGGTGGAGCATTCTCGAATGGTCATCCGCAGTCTGTGTTCTGAAGGACTGGTTGAGGTTCATTTTTA
AATTAACGCGTTATCCTCCATGGCAAACGTCCCGCAACAATCGTGTCCCAATGTGGTGACTGGAAATCTTGCGCGCCTTACACCCATCAACCTGATGCCA
GAGCGGTACTCTCGTCACATGAAGATCCTGACCAAACTCAAGCAGATCCGCCAGGTGCAAGTATCTCGAAGTATTGGCAACAGCTACGTCATTGATGTGT
ACACTGCGTCGCAGTCCACAACTCGCATCCCTACGACGATAAAGCATGTTAACAGCGACTCAAAAGGAAGGCAAGTAACTGCACTTTTCAGCCGACCTGA
GGTCCACGTGGCAAAGCAATTTGCTGATTTTGTGAAGTTGCGAGACGAGCTATACGAGGCCTGTCATACCGGACCCCACCTGTACATGAACTGCAGATTC
TGCAGTGAAGTGACCCGCTATTTGCTCTTTGGAGCCGTGCTTCCTGGTGTACTGACGACCTGGATGCTGGATGCTGCCACAACGTCAGCGAATGAGGGCA
GTGTAGCGATTTATTGAGTCTTTACTACAGCTTGCTGTTGCGTGTCCTGTAATCGACTTGGAAGCTTGTCCGTGTCAAGAAAAGCTACCGCGACAGCTAT
ACAACTTTCTCTTATCATGTTGACTAAATAAAACCGATTACTTGGAAAGCTGTTTCGTACTTGAGGAAAACTTTAATATTTTAAGCTACGAAAGGGTTAA
TAGGTGATCGAACCGGAAACACTGGAGGTGATGAGACAGGAGCCGTATAATTTCTCAAAGCACATGACTATTATAGTTCGTCAGGTAAAAGAACTGGTGC
GTAGCCCAGCTTCTTGTGGCAGGAAAGCTAGCGCTAGAGCCACCAACTCGATAATCAACGGAGCACTGCAAGTCGAGGTCTACATGTACATTGGCAACAA
AGAGGAATGAAATGCGCAATCGGAAGATACGTTTTGACCTTTTTGACCTTTCGTGGCAAAGCACCGGACCCTTTCGCATTCAGTGCGCATTCAGGTACGA
GACAGGCCGAAATTTATGGCATCACCTCTGAACTGAAAGTTGCAGAGCAAGCAACTTCTCACTTTAGAAATTCCTCGCGAGCATGAGCCTCTTGCAACAA
TCAAGCGACGACGTTGTCGGCGGTCTCGCGCGGCTCACTCCGATGAACCCGTTGCCAGAGCGATATTCGCGTCACATGCAGACTGTGACCAAGCTCAAGC
AGATCCGCTGCGTCCTGGTGTCCGCTGCCAACGGTAGCTACGTCATCGACGTGTACACGCCGTCGCAGTCAAGATCTCACATCCCCACCACGCTCAAGAA
TGCCCAACGTTTGGATGCCCACACTCAGAAAACCTTCAGCGACTTCGTTGAGCTCCGAGACGATCTTTACGAGACGTGCACATCATCCCATCACTCCATG
GCCTGCTCGTTCTGCAGCGAAGTAAGCCGTACCCTGCTGCTTGGAGCTTCGCTGCCGGGCTCGGTGCTGAGCTTGGTGCTTTCTCAACGTCAACGAACCA
AGGCCGTGCAGCGGTTCATTGAGAATTTGCTGCAACTCGCAACTTCCTGCCCCATCGTCGACTACTACACTTGTCCGTGCCAGGAGCAACTTCCACGAGA
ACTCTTCTTGTTCCTCTTCGGAGAGTCCGGCCCGTTGGGTTAAAAAGCCTTTTAACTCTCGACACGAGCAACTTATCTATCCCTACTTACTGTAAACAAA
TGAACAAGGCAGTTCTTAACATTAAAATACCAGCTGATAAAACCCAGAGGGTTTATCTTGAAGCGCGAGCCATGGACCATGATTTTTCATGATTCTTAGC
ACACTTGCAAATCAATTTTGCCGACAGCTCGGTAAAATGCTGCAAGCTTCCCACGAAGCAACATTCTTTCGCTATGCCTTGAGCTTAAATACAAGGGTCG
TGGCCCTGTTTCCATCGATACAGTGGCAAGACGATGATTGCCACCATCAATTGTCCTGCTCATCACAGCAACCGATACAAACACAAGGCGTTGACGCCAC
TAGTGACTACAGTTGCATGAATGTTTGTAACCACCCAACGCAATGTCACGCGTCTCCTTCAAGATAAAATAATTTATATGCGTTTAAGTGCGAGCATCTC
GATGTACACCCGCCATGTCTACTACTACGTAGTATCAAGATGACGTTTGAGTTGCTTGGCGAGCTTATTTCATTTCATGCCATGGAAGCCGCCAGTCAGT
CGCTAACTTAACACTCAGTTGCTCCTCCCCGAGCCTTTCGCCAAATACTATACTCCCACTACTCTCCACATCTTCACTGCTTACATCATCAACGAACAAT
GGTCCGCGACTGGCGTGGGCAACCTCCTGTTTACTCTGGACACACTGAGCTGAGTCTGTTGACCAAGCCCCTGTCCAGAGAAATCTGCCCGTTTCCTCTC
TCTCGCTGCTGTAAAGTCCGTCGCCTCCTGTCGACATAACGTCGGACACGGCGGCGGCGGCCCCAGACCGCCAAAATCGAAGCACTCCACTTGCTTCTCC
AGCGCTGCGGCCTGTTCCTGCTCCCTTCGACATTCGCCACACAGCTCGCCTTTCGAGCCTAGGCACTCGCCCCAGCAGCGTCCGGTGAATGAATGTCCCT
TGACGTCGCCGCCTGTCTCCTCGAGCATCGTCGTTCAGGTCCAGCGGGACAATCTCCCCCGGACGTGATAAAAAAGCGAAGAGAAAAAGCGCTTTTTCAA
GCCGAAAAATCGCTCACTTGGACCGCCACTGCCCTGTCCTGCTATTTATCCCCCACTCTGCGTCGTGTTACGCTGTTTGTGTTTGTTTGTTGCCGCCTCT
TTGACCTCTGTTGCTTGATGCCACTGCTCTTACGAAGTGGGCAGCGCCGTTTTGTTTTGAGAAATGAAAAACCTCGCAACAATTGAAAAACCCTCGCTCA
GATTACCAACATTCTGGACCTGGAAAACTGAATTCATCGGATTCTGAGGGAGACAGAAATTTCTGTGTTTACATGACAAAATTTGGTTTTCTGAGTGGTG
GTCCATTTTCCATGTTAAGCAGGACGTTAACAAACAAGTTATTTTAACCTTTCTTTGCCAACATGGGCGGTCTACATATGTATACTGTACATGTATTACA
TATAGGCGAAGAAGCGTTGAATGACCTGGAGTTTCATAGCTAACAAATGATTGCTTATTCATGAGTCCAGGAGAGACTTACATGCTTAAATCCATTTACA
CAGTTTCAGTATGATATGCCTGTGTGCGTCCACGTTAGGCCTGGAACGCACGGCGAAGTACATTTGCATGTTTTGCTTCCCTAAGCCGGCATGCTTCCTC
ACCTCGTTCATATACGTTGGTATTGGCGCCTTATACAGACTCTCTAACTCTAACAATGACCTTTGTACTGAAGACGACCTGAGTAACATGATATACTGCT
ATACCTGATAGAGGAGTCGTCCACGGGTCACATCAGGTAGGTAGGTTTTACTGTAGTGCAAAATTGAATCTACAATCCATGCTCTCAGCCTCCGCGAAGC
TCTAGTATATTTTCCATTTTGGGAGTAAGGATGGGGTATTCTTTGAGGTTGTTAGTTTGCAAGTATTTTTCGCTCCGCTATATTATTTGTTATTCCAAAC
CTACGGATGTAGTAATACTATAGTCGCTGAATTGATCCATAGACTTATGATCCGTGTAGTATTTCCCGCGAAACTGGTCATTATTGTTCCCACTGCGGTT
CATAAGAACACGACCAAGGCCTGTACACTGCACAGGCTAATCTTATAATAATTATAATAGAACAGTAAAGCGTACATCGTGCTGACCATGCAGCATTTAG
CGAGCCAATTCGGTTTCACAAGCCAGCTAGAAGATTATACCTTTTTTTTTAGGAGTATGACGGAATAGAGGAAGCTTCGCCGTTCTTGGCAAATTGAAAA
GTGACCTGTCTTATGAATAGCTACCGTTCTGTAGCATTTGGAGGACGTCTTCATTTTCTTGTTTTCACTCCTCCCTGCACGAGAAGCCGTTCTGTAAAAA
ATTAGAAATGGTACCCTGTTTTAAATCACATTACGCTATTTGAGGAAGATGCGTACGTCTGGAAACTAGAGGATTGGGCTGGTAGCTCTTGGATGTTCTA
CTTCCAACAGCTTAAAAGCCATGTTAGCTTTATGTAGGCATTTAGAAATTCATCGTAGATATACATCCCCTCCTTTAAATTACGATCTCACGTATACATT
TTTGAAAATAAGTTACTGTTATCTTTATTTTAATCCAGAAACGGTACTCGACCAAAGGAATATCCCTAGCTTTTAATGAGATTCATCAGTTAAAACTCGC
TTTGATGTTTCTTCAGTCTTCTATAATTTGGTACACCTGTTATCTCCTGTTTCATTTCTTATATCACAGAAAAATGTGATGGTATTCTCTCTTTGAACGA
ATTCGTGCGTACCCATATGTAAATGAATGCACCACTTCGTACCCAAAATAGATCGTTTGACCTCTTAGAACCAAAACACGGATCTTCAAGCAATCGAGAG
GTCGAGAGTCAAGCCGGGTCCGTAAACTGATAGTAGGGTATCTTTGACTTGTCCTTGCTGTTTGGATAGTACAGTGAAGGACATTGTTTAACGATCGTAA
ACCTTAAAACGTTTTGCCCAACTTTGCTTTGGGAAAGCGTCAAATAAAATATTCTTATGTCACTATTTTTTTAAAACGGCTTCAAAAAGTGACCAGTGAG
AATCCCATTTAAATAACCTTTTTTTTACAACGGCGAAGCTTAAAAATATTTCTGTTTCAACCAGGTGTATTATTTTTGGGATGTCATTTGAAATACGATG
TGCGGATGAGTGCATATCCTGCGGATCTCCACAATGGCACACGAACGTTGCAGCTACGCAATGGACGACTGCTTCGGCCTGTTGTGTGCTGGCTCGCGCT
GCCGACGCGTGGACTTGTGCACCGTGATGACCAAGACTTAGTGTTAGAATAGATGAGCTATTAGTGCTGAGTACTAATACCACTTACTGCTGGTGCGGTG
GAGATATTGGCACGGAGCTGCACTTACTTGAGCACTTGCCTTCTTAAGAGAAAGTGCAGACTCCGATTAAGACCTTCACCGTCACCTGCCGCATATACAC
ACGGCACGTACGTGCTTCTCTTGCTTCCTACTACCTGACTGCTGTTTGGTGTCAACATGACAGTCACACGGAGTCAGAGTGAACTGGTGAGCTCTCGTAA
CTTACCTCAGGTTATGAGCCCAAGAGAGAAAGCAAGTGCGGCAAAAAATGCAAGTGAAAGTCTTAATGCCGAAACGATGACGTCTCAAGAGCAACTTGTA
GACTTTATACGTGAACTTGCGGACATTCCGAACGGCGTTTCTCTTTTGACCCTACTATTACAAGCTGCACACCGTCGATTGGTCAATAATGTTCGTGCAA
GTGAGAGAGCCCCCCCCTGGCAGTCCAGAAAATAGCCAAAGAGTCGAGCAGAGACCACAAGCTACGGCGCAGCCTCCAGGGGCCCAGGAAGACCCGAGCG
AGCCCAGCGAGCCGAGTGAGCCTGACGAGAGCGAAGCCAGACACGTGGACGACAGAGAGAGCCGAGCATCTTCACACGGTAAAAGCATGCTGGACAACAG
GCTGAGAACACGGTACAACGACGCTGAGCTCGTGGACGCGACCAGTAAGATGATCGGCAAGGAGGTGGTGCTGCCCAAGCGGAAGGATGTCAAGGAGGAG
CTCGCGCGGTGGAGAAGCGAGGTGACCTTGCGGTTCCCGCTGTACGAGCTTGACGCGATACCGTACGAGAGCGAGAGGTACGACTCGCAGCTTGGCTACG
TGAACCCCAAGTATTATCGCTGGTACGACACGCGGCGTGTGATGGCATTCACGGCTATGGCTTTGTCTCTTGACATGAACCTACGAGACCTCTTCAAGGT
TGACGAAGTCAGAGAAGAGATGGAAGCTCCGTCTTTACTTTGGGGCCGGATTGTGGCCTACTTCACACGAGGTGATGGAATTAACCCCGACTACATCCTG
CGTGACCTACTCAACCGAGAGCTGAAGCCCGGTGAGACGGTGGATCAGTATGTAACTGTGAGTGAGGAGTTGGTTCGGCGTTATAAGCAGGCCAACGGTG
GAATGGATGAGTGGGAACACGCAAGTCTCCTGATCTCCAGCTCTCAGCGTGACTTCAGAGAGCTTGCAGAGCAACACACTGAATGGTGTAGCAAGAACGA
CAGACACACATTGACACGTGCCGATGCTACGCGTCGCCTGCGACAGGCGGAGCAAGCTCGACTGCAGGTGGCCAGTCTACAGGGATCGCCTGAAACCTGA
CGAGCTGCGACCGTTAATGCAGTCAACAAGAAGAGCACCAATAAGAAGAAGCGAGCTGCTTCGAAGACTGAGGAAATCGCCAAGAAGAAAGCACGTAACA
AGTGCGGGAATTGTGGTGAAATGGGCCATTGGTATGCAGAGTGTACGGAAGTCACTGGAAAGCCACTTAAGCCGGAGCTGGAGCAAAAGAAGCCTGCAAC
CTCCAAGAGAAGAGTGCAGTCGTTCGTGGGATCGGTGCAAGCTGTGCCCGAGACCAGTACTACCAAACCGCCGGTATCTCCTGTGTATTC