Description :
From Genome Similarity Track
Location :
Scaffold_90:1646- 7265
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_90-snap-gene-0.10Novel protein

Sequence
5619 bases(100 bases per row)
AGCGACTCTGCGTGTGGGACGTCGAGCAACTCGAGCCCGTGAAAGGTTGCGCGGGTAGCGTGGTGACCATCGACGCGGCCTTCGTGGCCTTTGACCCAGC
GAACGCCGACCAGTTCGTCGTTGGCGGCGACGACGGCATGCAGATCTGGAAGATCTATCGCGGCAAAGGCTCGAGTCTCTTGCGCCACGTGAGCGTCCAC
TTGGGCAGCAGTGCGGCCGCAGCGTCTACGTTCGGCCGCGTGGGCGTGCAATCGAGTGACGACGACGACGTCAGCGAGGCTGAGCTCTTGGATCTCGAGG
AGAAACGCAGCCAGTGGCTCTGCCACGCCTGGCTCAAGAATGAGAAGCTCCTGGCGGCCAACCGAGCCGGCGAGCTCGTACTGGTGGATGCGGCGACCGC
GACGATCGTGCAGATCATCGAGGTGGCTGTGCAGCCGAGTCGTCGCTGCATCGCGGCGGTCGTGTACACGGTCGATTCCGTGGTCGTCGCCTACGCGGAC
GGCCACGTGCTGTGGCTCAACGAGAAGACCTGGGAGGTCATGCAAAGCGCTTCTCTGCCAGTAGTTAGCTTGGAGGCTACTCGTGGAATCCAGCATGGCT
CTGCTTCTGCACTTGAGACTCCAGGTTCGTCGGCTACCGAAGTGAGCCTCGTGGCCTGCATGGCGCCGTCGCCCAACCACTCCAAGCTCTACATTGGCAC
ACGGGACGGTCGCATCTTTGAGCTCAAGAGCAGCGTACTTGTGGACGAAGAGGAGGACGACGAGGGCGGTGGGGTCATGGCCACCAGTCCTGGTCATACC
ACCAGCAGCAGCAACAACAACGACTCGCACCTGGTCGTGCCCTGCGGGAGTTTTCCTGTGGGCGCGGTGCTCGCGAGCTCAGCGCTCACGCCCTCCGGTG
GGACCTTCCTCACGGACGCTGTGGTCGCGAGCGGTGGCGTCAGCGGATGCCTATACCTCTGGAGCATCAGCAAGTGTCGTCTCGTGGTGGACGTTAGTGT
TTCTTTGCTGTTCGCACACCCACCAACGTCCCACTCAGCGTCCTCCGAGGGGTCCTTCAGCGGAGGACAACCTGGTGGACCGAGTCAGTCGAGAGGCTCA
CTGAATCAGATCTCGGGCTCCGAATCCGACGAGAGCCTGGCAACCGCACCCGGGAGCCATCTGAGCGCCGAGGCCGCGCCCTTGGTCATCATTACGGCCC
TGGCGTCCAAACCGGCGGATCCCGTGCTCCTGATCGGGGACCAGACTGGCCGGCTGCGCGCGCTGTGTGCGTCCAAGGTCGGCGGCGGTAGCGGGGCCGT
CGAGCTCCTGCCTCTTCACTCGCTGCAGCTTGTGGCCGACGCGCCGCTCGACATCCTCGAGATGCACCCGACGCAGGCCGTGGTGCTGGCCGCGTCCACA
CGAGCCAACACGGTGTTCATCCTGTCCACGGACCACGAGAGGCACTTCGCCGTACTCGCGTTCTTCCCACTGCTCGAACCCAAGGAGCACGTCGTGGACG
TTCAGTGGAGCCTGCCAGCGCACAACAAGAGCGCGCTCATCGCCACGTGCTTCTCGTCCAACGGACTCTTCTATGTGGCTCGGTACCAGCAGAGCGACAC
TATTGACGCGAGTGACCCCATGACGCCGCCTCTAGAACTGCGAGCCAAGGTCGTGGCCTTTGGTGAGGACATGCTGCCCAAGTGCTCGAGTCTGCGGTTC
TTGGGCAACGCGCCCATGAGTATGATGCTCGCGACGGCCCCCGGTGGCAACAGCGTCCACGTGATGAAGTACATGGAGATAGTGTTCGACCCGACCGAGA
AGATCAGCATCCTGGCCAAGGTGCTGGCCCAGGACGCCCATGAGAACGGGATCGCGACCATGGCGCTCTATCCGCACGTGTTGGCGGACGGTGCCGAGCT
CGTGGCCACGGCCGGCATGAACGGGGCCATCACGATCTGGCTCGTGGCATTTGGGGCCGGCGACGCCACTGATGGTGAGGCCCCACCTTCCGAGATTTCT
ACACTATCGGCTGGTAAAGAATGGCAACTCGAGGACGTCCAGGCGGCCAAGAAGAAGACGATCGTGGTCCACACGGGGCCCGTGACGTCGCTCCTCTTCC
TCAACGTCCAAGACGACGTCTACCTTGTCTCGACGGGCAGCGACGGCTGCGTCTTCCTGCTGGATGTACGCATCCCGATCGAGTCCAAGGCCTCGGTCTC
AGATTCAGACCACGAGCTCAACATTAATCCGCTATACCTGAACGTGACGACGTTCGCCAAGTACGGCGAAGCGTTCAAGCCGACCCAGGAGCTCGAGCAG
AAGCCGTTCCTGCAGGTGCTCCAGGAGAACGACGCCTTTGCGGCGCGCAACCGGTTCGATCGACTCAAGGACCAGACGCGCGCGCAGCTCAACGACCTCG
AGCTCAAGCTCAAGCTGTTGCTCGCCGAGAACGACAAACTGCCCGAGACGGAGCGGCTTGCGCGCGACGAGTTCGTTGTGAACGTCGACTGGCGCGACCA
GCTGCTGCGCAGGAACAGGGAGCGCGCTGAGCGCGTACGCGAGGGGATCCTCAAGGACCTCGCCAAGATGAAAATTGTGCGCGAGCGCATGAAGCACGAG
TTCTGGGACTCGGCCACAGTCCAGGGTGTGCGGCTGCGTGGGCTTTCACCGTCTGTGCCTGGGCTTGGGTCTCAGCAGAGCAACGGGCTCTTTGTGTACA
ACTTCCCCATGCGCCGGCAGACCAAGCAGGAGCTGCTTACGGCCAGGAAGATTGAGCTCATGCGCACGATCGAGTTTGCTCACCAGCAACAAGAGGCAAT
CGACAATGCGGGTACTTCCCAAGGCTCACAGACGGACACGGCGCTCTCGCGGTTCAACCAGGTGCTGGCGCCGAGCAGCAGCAACCTTCAGTGGCTCATT
GACGCGGGGCTGCACCACCCGTCGCTCAATAAGTGGCTCGTGGACAAGGTCAAGAGCTCTCCACCAGCGACAGGAAGCTACGCGGAGCTGCTGCCGCACC
AGCTCGTGTACCACCCGGCGGCGATCCGCACGCGCAAGCAGCAGCGCATGCAGGTCCACGTGCTCAAGGTCTTTGTGCGCGCACTCGTGGTCGAGTTCAA
CGACGAGTTCAGCGCGCTCATGCGCCTGAAAGAGGCCAAGATCGAGGAGATTGAGGCCAAGAACTCGCGCATCCTTGAGATCGGCGCCGAGCTTGGCGTG
TCGCCGGCCGCCCAGGAGCTCTACCGACCGCAGTTGGCCCCGGACGAGATCGCGGCGTCCATCCTGGAGGTCAAGCCCGCCGAGATGACGCAGAAGATGT
ATGAGACCGAGGAGATGCGCCGCAAGCGCGAGAAGGAGGCCCAGGAGAAGCTCGAGCTCGAACGGCAGCGCCAGAAGGACGACGCGTCCGGCCGCGCGCT
CACAGACATGATGGACGGCACGCTCGAGGTCAAGAAGGAGAATCTCGCGACGCAGTCGTTCGTCAAGGAACAGTGGATGCTCGATACATCGGCCGACGAA
ATGACGGCCGAGCAGAAGAAGCTCGTGGCTCAGTTCGAGCTCGCGCAGCAGAAGTTCCTGGAGGAGAAGGAGAAATACAAGAAGAGTTTGGACCTGGAGC
TCAAGAAGATCCGCGGTGAGATCAGCGACGTGTGCAAGGCCTTTGACGAGAAGCTCCGCGGACTCCAGGAAAGCTACTTGCACATGCGCAGGAGCGTGCT
CGTGCAGCATCTGTACGAGCTCCGGCTCGCTGAGGACCTCATGGACCATGAGCAGCTGCTGCTGGGACGGCAGCGCATTGAAGGCGCGATCTTGGAGCTC
CAGGCCAAGATTCGAAAGAGCGAGCGCGAGAATGAGCTCTTCGCAGCTCAGCTGGACGGCTCCAAGGACGAGTGGCACCGCACTGTGGATGAAGACAAGA
GCTGCGAGAAGAATTTTCTCCGAGATCTCGAGGAGCTTACGGGGGGCAGCACTAGCGGAGCCGGAGCTGCCGGAATTGGACCAGCACCAATGGAGCACGA
CTTCATCAAGCACCTCGTGGAGCTCTACAAGAAACGGAAGGGCGACGACTTGATGCGTGACGGCGGAGACGCCGTGGCGAGGAAGGGCGGTACAGCCAAA
CGCGGGAAGAGCTCGCAGCACCTGGGCATGGGTGCCAGCAGCCTGCAGCTCAACGCTGGGACCTCTGCGAAGGCGCGACTACTCGCTGAGGGCCTGAACT
CCGACCCGTCCTCGCGCAGTCTCTCGCCAGTGACGCTGCTGCAAAGCCTGCAGCATTCCAACAGCGATGGCGTGGAGGGCGATGCGAACGTGGACCCATT
CCAGTACTTGGACTACCAGCAGCAGCCGCAGCTCAAGCGGCTCGACTCGGGCAGCGTCAGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCGTCCCACTTGACTACGACGTCGACCGGCCCGACAGCGTCC
TCATTGAAGACCGCGTGTGGCGCGCACTTAACGCGCTGCGAACCAAGAAGATCCTGGCGGAGCACAGCGCCAAGGAGAAGGCGGAGCAATACGCGCTCGC
CAAGAGCGTGGCCGAGGAGCTCCGCGCCAATATCACGGAGCTCCAGTATGCGCTCCAGGAGCAGGTCTCTGGCTACGAAGCAACGACGCGGCAGCTCGAG
GCGCTTGCGGACAACTCGCCACTGCTCGTGCACATCAAGCAGGGCCAGGACGAGTCGAGCACCAGCGGCGGCAGCGTCGACGCGGAGGACCTTCTTCGGT
ACGCGGCTCCGGCGGACGCGCTCCTGGTCGCGCGCGCCAGCGTCGAGTCGCTCAACGACGTGATCCAGCTCCACGGAAAGGACCAGGTGGGCATCCTGGG
CAAGATCAAGAACTTCCGCAAGAACATCAATGTGATGGAGTGGGAGCACACTCTGCTACAGATGCAGACGCGCGACATGGAGGAGCGCTACACGGACATC
CAGCTCCTGCGTGTGACCAAGGACCTCCAGGAGCTCTTCCACACGGGCGACACGTCCGAGAAGCAGAAACGCGAGGTCGCGCTGCTCCAGGCCAAGATGG
TCCACCTCGGTAAGAACCACCAAACGAACTTACTTAAGCTCGACCAGGTCATGGCCAAGCTCCACAAACAGTGGCGCGAGCGCGTGCGCGAGAACCAGGG
CTTCGAGCAGCAAGCCCAGCAGCTCCAGATGCAGGTGCAGATCCGCGAAGACATCCTCTCGAGCCGCAAGAGCGCCGCGCTGCGCAACGCCTCGGCCGGA
TCCTCGTCTTCATACGAGGCCGCGGAGAACCCGCAGCTCAAGGCGATCACTGTGCGGCGCAAGCTCGTGGACTTGGCCAGGTCACAGACCGAGGAGATCG
AATTTCTGCGCATGGAGCTGGACAAGATGCGCCGGCGCACGTTCCCGAGCTTCGTGCAGCACCAGGCGGCACGCGAATACCACGCGAGCGACAGCAAGTA
GGCCAGCAACAAGCCTATA