Description :
From Genome Similarity Track
Location :
Scaffold_85:164576- 166963
Transcript NameFunction/comments
Physo_158136hypothetical protein

Sequence
2387 bases(100 bases per row)
CATCATGACAGCGCATCCAACAACGCTCCGATACGCGATTCGGCAGCACCTTCGTGCGACTGCCGCCGACTGCCCCAACGTCCGAGAGTGCTGCCTCCAC
CTCCACCGCCATGCCCAGGACTGCCGTCTTCCTTGCGGCCTTCCACATCGATACGCAGCCAGCGCGTGGACGTTCCGCTGGCGAAGTCAAACTCCTGAAT
ATGCCGCGTCCGAACTCGCAGCAGCGGGGCGGGCGTCATCCCACCGCCGCTCGCGTCGTTCGAGTCGCCGAAGCGCTCCACGTCGTCCAGCAAATGGAAC
GAGAAGGCGCTAAACACAGTGATCAGGAAGCGGCTCGGACGCTCGGGCGACACGTCGATCTCAATGGGCCGTCCTCGCGCCTCAGCCGGTCGGATGATCA
GGTTCGGGTTGCCCAGTAATCGATGCACCACGAAGTACGAGTCGCCGCCGCTGATCGTTCGTGCGCACGCCTGCAACAAGGCGCTCACAGCGCGCACGCG
CTCCTCGGGGGCAGCCGCGAAGCGCTGGATGTGGGCATCGAGCACCTCAAAGATGTGTTCAAGACCGCGGTTCTGTTGCGGTTGAGTCGAAGAATCACCG
GCGTTTTGCTCCGCTGCTTGTTGCTGTTGCTGCTGCTCGCCTCCACCGTATAATGTGTCATTGATGAGGAATAACTCGGGTAGAATGTCACGCAGCGTTT
GCTCGAGGGAGATCGGCTGCGGTCTAGGCAAAAAGATCTGAGCGAAGGTCTCCGCATGCCGCGAGAAGATGGCCAGGTAGTCTCCGCGTGTCCGCGCGCG
TGCCGCCTTCTTGCGGATCGCAATCTGCTCTGGCGGGTGGATCTCCCACAGCAGCGGATCGGTCTCGCGTAAGTACTGCACACTCCCCAGTTGCTGGTAC
GATGCCGTCCAGCGCGCGGTGGTGGTCCGCAGCTCTTCCGTGTCGGCGTCTTCCACGTCCTGCCGCTCCTTCTCAGCTGATAGTGACAGCGCTGAAGACG
CGAGTGCCGCCTTGGTTGCTGTAGGGGACCGAAAGCGATAGAACGGCGTTTTCCGCTTCTTGTGGGGGGTCGAGAAGGGTCCAAACGACGACGAGGAGTG
AGCTGGTAGCGTCGATGAAGAGCCGGCTGTGGCTGATGCTAGTTTGCAGTAGAAGGAGGCGCGGTTGAGTGCTGCTACCCACGCACACACAGCAGCCTCC
GTCTCCTCAACAACCCGCAGCTCAATTGATTTCCGCCTACAACAACAAGACAAGCGCAGAGTTAGGTGACGCTATGCAGTATAGCTCAGCCATACCACGT
ACGGGAAGACTTGGTGCGTGAGTCTGGCTGAGAACTTGAGGACTTGCAGTCGCCGGTGTGAGCTCGCACTCGAGATACTGAAGGCCATGGCGTGGTCACC
ACGACCGCGTTGAACGAGTGCATGGTCCAGCAGTACAGCACCACGCGGAAGACCGTCGGCTTCACTAGCGAAATAGTACAGCCGGTTGCCTTTGAGCTCG
AAGTAGCGCGGCTGCCAGGCGCTGCCGAGGCCGTGTTGCTTGCGTTTCTTCTTCTTGAGCCAGCCCATCTTCTCTGGAGCCAGGTGGGCCACTGGATCCG
TTATACTGTCGTCGTCGGTGATAGATAATTCCCCCTGCAACGACGCATGCTCTGACGATCCCGAGGGCTGCGACGATAACGAGAGCATGGACCACGACAA
CGGGAGTGCGGAGACTTGCTCGCTGCTGTCTTCTTCCTCCTCTTCGTCGTTTTGGCCGCGATCGGCCGACATCTCCGCCTCCTCTCTTTGCCGCTCTCCA
TCCGCACGAGATTCAGCTCTATCTCCGTCTTCTCTCTTCTTGTCGGCCATTTGAGCTTGTGATAGCCGCAGAACCTCGATATCCTCCGCCACCAGCGTGC
TGAAGGGACTCAACTGGAGCTTCTCCTGGCTCAGGTCGTCGTCGTCACTCCTCGTAAGTTGAATAGGGGAGAGCGGAGGCTGCGGATCACTGCTCTCCTC
ATTGGCAACGCCAGCCGCTGGAGTCTCCGCAGTCGGCAATCCAATGAACGGGGAGCTCGTTTGCTTGGAGATCTCAGCTACAGCTTGGTTGATACGATGC
GCCAGCGTAATATGCTCCGCGTGAAGCTCTCCCGAGCGCGTGAGCGGCAGTGAAACGGTGACGGCCCAAAGCTGTCGCCCGATCCATTGCAGTGACACGT
CCGGGTTAATGGCATTCGAGCTGGTAGACGGTGGGGTCTGGCTACTGGTACTGGAGGTGTCCAAAGCCCACTCGGAGACCACTCGCGCCACCTTGGAGAC
AATGGCAGCCCCAGCCTCCATCGTCCAGCAAGTGATGCAGGCCTTGAAGAAGTCGTCCTCCCGATACCAGCGCTCTACTCGAGCCTG