Description :
From Genome Similarity Track
Location :
Scaffold_31:164534- 167484
Transcript NameFunction/comments
Physo_116205PREDICTED: similar to DNA-dependent DNA helicase and ATPase

Sequence
2950 bases(100 bases per row)
ATGGCGTTCAATCTGCAGGCCACAGAGGCTTGTGACGTGTTCTACGTGCTGTGCACACCTGCAGGTGATCGGGATCAAGACGTGTATCGAGCTTTCACAA
CGCGCACGATTACATTTTTGAGTTGCGTTAAGCACGATATGCAGAATGGATCAGCTCGCGGGGTTGGGACGGCAACTCGGCTGCATTTGCACGCCTTCAT
CGCCGCTGCGCTCCGTGGTGATGCCAATTTTCAAGGCTCAGCGACACGAGAGCAAGTGGAAGAAGCACTTGACCGCTGAAAACAAATGAGCGGAAGCAAA
CCACTGGTATTCTTCCCGGACGAGTTTCCGCGAATCCAATCGCCCATGCCTCGACAGGAACGGGAGGAGCGTGAAGCAATGGTTCGATTGTTGAGGAGTG
TGTTCCGCTCCTTTCGGGTACCCGTTGTAATCAGCGCCACCAACGGGACTGCACGACGCATTTTTTTTTTGGAGAAAGATCCCGAGTTACATCGAGTTTT
GAGGATAGAACCCCTTGGTGTGTTGTGGTTCCGTCACTTCCTGCATTCGTCTTAAATGAAGATGGCGTCGCAATCACTTCGGATTCGGTCGGAACACGCA
GGACCGGCACTATACCTGCTGGACTCTTTTGGATCGTCAAACACAGCCGGCCACTTTTCGCGAGGGAAGTGTGGGAATACATGAGCCGGCACCGTGACTA
TGGCGAGACTCCGGAGGACTGGCTTCATTACTTGAGCGATATGACGAAGTACTTGGCACCGCATATCCGAAGCCTCAAAGCCCGCATTCGGTCTGTCGAG
TCTGAGCTTGGACAAGTCAGCATGTTTCTCGGGTCCACCTGCAGCGTGGACAACAGCTATGCTAATCTGGTCGACGGCCACTTTGCATGCCTTAGCGAGT
CGAAACCCTTTGAGCTCGATTTGGGTAGTGGAGACATACTGTTTCAAGGCGACAACCAGTGGACAGCTCGCTGTCAGCTCCCGCCGCCGGAGAGGGATAT
ATTGCTGCATCTGACTCTGATGGGAGACCACGATAAGATATTCGATGACTCTGGCGAGGACGAGGAGGGGGACGGGATGTTGCGGCCACTGAAATGTTCA
CTGTACCATTCGCTGCAAGACAACTTTTTCCGAGGTACAGACCTCCGCGGTATGCAAGAGCTAAATAGCGGTAGGGCGCTCGAAAGTCTTGTTGCCGGCG
CAGTCGTTCTTGCAAGCCATCGCGAGAAATTTTGCGGGGTGAAATTCCCAGCGTTCTTATTTTCGTAGAGCAGTCTGCCTAAGAAGGCAGACTGCTCTAC
GAATTGGGCGTGGTGGACAAAATTGACGCGGAGGTTGATATTCCATCAAACCATGCCAAGAACACGAGCACGATCCCGTTTCTGTCGGCGCCTAACACAG
AGTGGCCGAGTTCGTTTCTGGATGCGTGGCGGGGTAGTGGTGCCCAGTTCGCCAACCTGTGTCGTGTTGCTGATTCTGAGCGGATTGATTTTAGATTCGT
CTCAAGTGAATGCGGGCTTTCTGGCGAGTGCAAGGATCGCAAGGGCAGTTTAGACGTGCGAACTCTCATAAGTGTTCTTGATCGTGTTCCGAGTTCTTCT
TCGATCCACTTGGTGGTGGTGAGAAAGTTACACGATACGTACTTCGGCAACCTTGGCGACCCGGCGGTTCCATCGAATGCTTTGGTAAGTGCTAACCTGC
AGTACGCCGACTTTTTCCGCATTTCGAAAGAAGACGGCGAGCTTGTGGAGTTCGTGGAGCTCATGGCAGCCAAGTCGACGACGATCATCTCCGACAAGGA
GAAAAGTGAGAAGGGGGGAGGCAAACTCATTTTGTTTATTGAGATCGGGGATTGGGATAAGGCAGAGTAGCATAAGAGATCCGTAGTGGAGATGCCTGAA
TCCCTGAAAAAGAAGCAAAGGTTAGCGAAGCAGTAAAAACGAGTTTTACTTCAGATATGGCCAGTTTGCTCGGTTTAAGAGAGCTGTTTCAGTTTTTTAA
AGAATAGATCAGATAACACTTTTTAAAAGTGTCATTAAAATGGCTACATGTTCATACAATGGTTGGTACTGTACAAGAATATTTAACGGGGTAAGAAAAC
TTCAAAACGACGACTTCAACTTGACCACTTCTCAGATTCTAGAATCAGACTGACTCAGATTTGTATATACCTGACTCGATCATTTCCATTGTAGCAACCA
ACGCAATGCGTCAATATGACTCGTCCCCTAGCAGCCTCGTGGACGCCGCCACGTGCGTGTGGAATCAGTACTACCCAGAGGACCACAACATCGGCACCCG
GCAGCCGGGCGAGACCCGCTCGGCGCAGTATTACAGCCCCATTAGCGACACGGACGGCCGCTTCCAGGCCGCCATGACCTTCCTCAACTGCTTCCGGGAC
GGCGAACAGTGGGCGCCGCTGCTGCAAGTAATGCAACCCCAGTATTACTATAACCTTGTAATTTATTGTACTAATATATTAAATTGCCAGTGCGACTTGA
CGCAGCCGAACGTGACGGTGGTGTGGCTCCACTACGCGGAGCTCATTCGCACGGGCACGGCGGACTTTGAGCGCGCGCTGACCGAGAACATCGAGGACGT
GCTGCTGTGTCTGGGTATTGCACTGTGTATGCGACGTCACGAGCTGCGCGTGGAGGCGGAGGAGGATATCACCAGGAAACGCAGTGTGCCGGTGGACCGA
ACCAAGATCACGGTTCGACTGCATGGAGTGACGCCCGTGCTGCCCATTGCAGCACTGAAAGCGGACGTGGTGAACCAGTTCGTGAGCGTCGTGGGGACAG
TGGTGAGAGTCAGTGCCATTAAGCCGCTGGTCACGAGGTGCGACTTCGTGTGCGCCAAGTGCAACGAAGCCACGTCGCGAGCCTTCCCGGATGGAAAGTT
TGTTCCGCCACAGAGGTGCGAGAACTCGCCGTGTCGAGGGAGGACGTTGC