Description :
From Genome Similarity Track
Location :
Scaffold_1434:1645- 5361
Transcript NameFunction/comments
Phypl_g13398hypothetical protein

Sequence
3716 bases(100 bases per row)
CTTTCTCGTTCCTCGAGCTCTATCGCTTTGCAACGCCCTCGGATCGAGTGCTGCTGGTATTTGGTGTGATCATGGCGGCAATCAACGGCGCCTTGTTCCC
ATGCATTGCACTGGTATTTGGTGAGGCCATCGCGGCATTCGCCCAGAcggacggcggcgtggaTCGCGAAGCGCTCAACACGGCATCGCTCCACTATTTC
CTTATCGCCATTGGCCTCTTCGTGACGGACTATCTCGCCTACTTGCTCTTCTCTCTCTCGGCTGAACGGCAGATGAAGGCATTGCGAGCTCACGCGTTGC
AGAATATGCTCTACATGGACATTTTGTGGTACGATCACCACGATCCGCTGCAGCTTTCAAGTCGAATTACGGGTGACACCGTGAAAATCAAAGATGGCAT
GGGTCAAAAACTCGGAGACTTCGTCAAGTACGTGTGCCAGTTTATCGCGGGATACGTCATTGGCTTTGCGCGCGGATGGGATATCACGCTGGTCATGATG
TGTGTCATGCCGGTGATGACTTGGTCGATGGCATATGTCCTTCGAAGTTGGCAGGCTCGTGCTGCTTACGCCCAGCGGATGTACGCAGAGGCGGGTGCTG
TGGCGGAAGAAACGCTCAGCTCGATTCGAACGGTGAGCTCACTAACGGCTGAGCATCGCACAATACAAAAGTACAACGAACGAACTTTGGCGGTTGAAAA
GGGAAACATTGCTCAAGGACGCGTGTTTTCTCTCGTGCTCGGAGTTTTTCGTGGTTGTTCGTGGCTGATTTACGCTGCCGGTCTGTGGTATGGTGGATAT
CAAGTTTACAAAGGGAATGTGTCGCCCCAGCAAGTCTTCCAGTCGTTGATGGCAGTCGTCATGGGCTCGCGCTCGTTAGCATTCATCTCACCAAACCTTA
CTGCTGTCATGGATGCAAAGGGGGCTGCTATTGCTCTCTACGAACTTCTTGACACCCAGTCTCGAGTTGACGCCTCCCGTGAAAGTCAAGGAATCATCCC
AGATACATGCCACGGCGATTAACGTCGACTTTGCCTACCCTAGTCGAATGGAAGCTCCCATTCTAAGGAACTACTGCGTCACGATCGAGCCTGGCCAGAC
TGTCGCGTTCGTGGGCGCAAGTGGAGGAGGAAAAAGCACGATTATTTCACTTCTTGAGCGCTTCTATGATCCGACAAGCGGCTCGATTCATCTGGATGGA
CATGATCTACGAACACTAAACATTAAGTGGTTACGCTCACAGATTGGACTTGTATCCCAGGAACCCGTGCTGTTTGCAGCAACCATTGCGGAAAACATTG
TGGCTGGACGCACTGAATTCACACGTGACGATGCCATCGCTGCCGCGATGTTGGCCAACACTCACACTTTCATCATGTCGCTCCCTGAAAGGTACGACAC
GCTGATCGGTGAGAAGGGTGTGTCGTTGTCAGGAGGTCAAAAGCAGCGCGTCGCAATCGCCCGTGCGATTATTCGAGAGCCGAAAATTCTGGTactggac
gaggccacgaGCGCTTTGGATGCTGAAAGCGAGCGAATTGTGCAGGAGGCATTAAACGACCTGATGGCCAAGACAAACATGACGACATTGGCGATTGCAC
ATAGGTTGAGTACGATCCGACATGCCGACAAAATTGTTGTATTAGCTGACGGTCACGTGGTCGAAGAAGGTTCGCACAACGAGCTGGTGGGGATTGAGCA
TGGCGTTTACCGAAATTTATATACAATCCAGGAGGCGAAAGCCCAAGAAGAATtggaggctgcagcgcttgcttTGGCTGAAGCCGGATCAGAACAAACT
CAGCAGAAGGAAGAAAATCCTGGCGGGTTGAGCCGACAAGTGAGCAAGTGGTCAATGAGAAGTAATGATACTTGCACTAGTGGTCGCCAATCAGCAACTG
GAAATCAGGAACTCGGGGCTGGAGATGCAAACGAACCGTCAAAATTTACTGTCGCACTCGCCAACGCTATCAGTAGACCAGAACGCAAGTACTTCATCCT
GGGGATGGTTGGTTCAGCCATCAATGGGGCGGCTTACCCCGCTTCGGCAGTCCTCATCAGTGAATTGGTCGCAATTATGACCGTCGACTACGCCAACTAC
AAGGCGTATGATGATCGCTCGTACATGTCCACCTTGCCCCACGAAGTCACAATGTACGGTATTCTCTACCTTGCTGGGTCGGTTCTTCTCTTCGCTGGCG
CAGCAATTCAGAGCTACGGATTCCGATTCGTAGCTGAAAAGCTGTCGTCTCGACTACGAGAGATGCATTTTACCTCACTCTGCCGTCAAAATATTGCCTA
CTTTGACGAATCGGAGCACGCGACAGGAGCCCTCACTGCAGAGCTGGCAACAAGTGCATTGCGCGTGGCATTGATCACTGGAGAAGCCCAAGGGCGATTG
TTCCAAGCGGTCTTCACGACTGTAGCTGCACTGCTAATCTCGTTCTTGTCTGGTAGCTGGCTCCTCACGCTTGTGATGCTGGCAATCATCCCCATACTGG
TGCTAGGCAACGTTTTCTGATCAAAGAACATGCATGGAAAAGGTATTCTCGCTGATGACATGGCAGACGTTGGTGCGCATGCTTCGGAGGTACTTGGCAA
CATTCGTACTGTGGTGTCACTTGGACTTGAGCCGTCATCATGTGATAAATTCTCGACCCTGCTTGACGTGCCGAGGAAAGCGGGTGAGCGTGACGCCCAG
GTAAATGGATTGGCGGTGGGCTTTAGCTCTTTTATTGTCTTCGCGACTTACGCCTTCACATTTTGGTATGGTGGAAAGCTTGTCAATGATGGAACGATCA
CTTTCCGCCAGTTGATGCGTTCGCTGATGGCAATCATTATGTCTTCACAAAGCGTGGGCGCCTCGGTGGCCTACGTTGCTGACTCTGACAGTGCGTTCGA
GGCGGGGGATACCATCTTGTCAGTCCGTGATCGACATCTACCTATTGACTCGTTCCAAGAAGATGGTCTTCGCCCTACAGACGTTTATGGCAAAATCGAG
TTCGAAGACATTATGTTCAGATACCCCACGCGACCAAAGATGGCTGTGCTGAAAAATTACAACCTTACCATCGAACCTGGTGAGACTATTGCTTTCTGTG
GACCGAGTGGCGGTGGCAAAAGTACGTGTGTCGCTCTGCTGGAGCGCTTTTACGATCCGATTCGGGGCCGGGTGATGTTGGACGGAGTGGATATCAAAGA
GCTCAATGTCCGGTGGTTGCGCAGACAGATCGGCCTTGTTGGTCAGGAACCGACACTGTTTATCGGCACAATTGCGGAGAATATCGCGTACGGTCTGGAC
GAGATGCCGGACatggaggagatcaaggccATGGCCAAGATGTCGAATGCGCATGACTTCATCATGCAGTTCCCTGACGGGTACGAAACGCAGGTTGGCA
TGAAGGGCGAGCAATTGTCTGGCGGTCAGAAGCAACGAATCGCAATAGCGCGTGCGATTTGAAGAACCCCAAGATCTTGCTGTTGGACGAGGCGACAAGC
GCTTTGGATTCGGAGAGTGAAAAGGTTGtgcaggaggcgctcgacAAGGTTGTGGCTCTTGATCGTCGCACCACCGTCGTGATAGCGCATCGATTGTCAA
CGATTCGCAAGGCGGATAAAATTTGCGTCGTGAGTGGCGGCAAGGTCGCGGAGCAGGGCACGCACCAGGAGTTGATCAATCGTCACGGCATCTACGCGAA
GTTggcagcggctgct