Description :
From Genome Similarity Track
Location :
Scaffold_71:164498- 167785
Transcript NameFunction/comments
Physo_139198ATGSL10 (GLUCAN SYNTHASE-LIKE 10); 1,3-beta-glucan synthase

Sequence
3287 bases(100 bases per row)
GGCAGGTCCTAACTAAAATAAAGTGTATAAGCTGGCCAGTGGCTATCAATGTCTCCCAGCAACCTTTACAATACTGGATCTAATGAGACACGACGACGAT
GGCAAGATGTTTTCTATTGATGAAGCAGCACACATGAACCTCACCACTATCATAACGGCTAGGTAGCCTACAATCTGCAATATTTGGTGTGCTAGTTACA
CTATAGTAGGAACTCATATGTATGTAATGTGAGGGTTCATTATGGTGCCTTGCTATCTATCGTTGCGAAGCTCAAAGATCTAATGGGGAAGGGTGACGAA
GCCGGGAACGGCGACGCGGTGTATTGCGTTACTTGCCTAAACTAAACGCTAGTCGCCGTTCTACTCGGCATATAGCTACGTAGTCTACCGGGGAACCGGC
GATGCACTTAGCATTGCATATGCTGAATTGCTGGACTGTGTTATTAGTGGGTACCGTTGTCGTTTTTCAGTTGCCTCTGCAACATCGTTTGATATGAATG
AGGATCCTGGGGAAACGTTGGTTCATCGTCACGCAAAGGATCTACAACGAATATGTAGATTCTACATATTCATGCTGCTTTTCGTTTTACATTTTTATCC
TTGCTGCGTTATCCTTGCTGCGCGGTCCAGCCCATAATAGTCTCTCTTAGTTCATGTGCCAGCGAAGAGACGTGAGGTGTAGCCTCCATCTACTGTAAAT
AATATGCTTTCTAGAAGTTCCAGTAGTTAGCATTTACTTATCATTAGAATCTACAGCGCGCAAAATGGTTTTGAGTGGCCGCCTAGTAGCCAACTACAAC
GGAATAAGTACGCAGACTCGGCTAATTTCCTGTAGCTACAATATGACAACAGTCGCCCTATTATTGACGTCCAGTGTAGTTAGTAGACGTCTTCACTGCT
GCCGACAATATTAAGCTGCAGACGATAAAGTAGCCCTTTGCAAGCTTTTGCCCTCATTGCAATTTGCTATTCGCAAATGTATCAGTACTTCCCTGATTCA
CTGACCCTAAATGCTTTAGTACTTTTTAAAAATAAGTGCATGTAGGTGTTGCGAGGTTCGCCCACGCGTAGCATACCATTGAACACGCCCATTTGTCTCA
ACTGAGGTTATTTGCGCTGCGCACACCATGTTATGCCTCAAGTGTGCGTCATTTATCAGGGTCAGTAGCGATAACTATTCCTAATTAAACGGGGTGTATA
AGGTTGCCTCATTGCATACCTTAACATCAAGCCGTGGAGGCGGATGAACACCGCCTGAGTACTGTTTTCGGGCTATGTGCAGTCTAATAGACGCCCGCGC
GTGGATAGACAATCGCATCGATACACAATGCTCTACAGGACGCACCTCAGAACACCATCCTACTTATAGAGAACGCAGCTATCATAAACTTACTTCATTA
GATACGTAGAACCAACCCTAATACGGTAGCTTCAATACCGACTTGCATCAATCAGGAAAACGCAAAGACTGTATAACTGCTTTAGGTGTCACTGCGTGGA
TGCAGTACATGCATGAACAATTCAGACGGTGTACTTTAGAATAGTCCCCACGATAATGGTTTTAAATGAATGCATGCTACAAAATCTGTTTGAATGGGTC
AAACTTAAGATTGGTACCGGTACAGCTTTTTCATTATCTCAAGGCCTACAGCGCCGTGCTTCCACAGTGCTCGGGTCTAGGGCTGTTTCGTGCACCGGTT
TTGGTAGGGTTATGCCTGTAATTTCAAGCTTTTTAATCGTTCGTAGTAGAGAATCTTCATTGATGTCTCAATGGGCTATCCCCGTAATAAAGGGCTGATG
AATTTGCACAAAAGTACTTTCGTGCACTTACGAAACAGCCCTACTCGGGTCGCGGTGCTGAGATCCGTTTAGGCGCTCTTTTATAATTGGCTGAAATTGC
TGTGTATTAGCCAATCGTCATTGAGAATTAATTTAGTGTGGACCACCGGAGCGTGACATTTTTAAGGGCCGCCACGATTATATATCTGATCCCAGCTCCC
ACAAGGACCAATTTGTTATGGAACCACTTCAAAAAAAAACGGAATGCTAGCGTCCAGTTTTCGAATTCTGGCTTTTGATTGGCTAATTGTGCATTCTACT
AAGTACGAAAAAGGTAATTTTGAACGCTCGTTCCTAGGGAGGGAACGAGGTTAAAGCACTGTTGAGCCAGCCTTCGCCATTTACTTATTCAAAAACCTTA
CGATGAGTTAAGGCTGTGAACTGTTGCCTGTCTAGATCAAGCACAATTTGGGCTCGAGATCGCACATATAGTGTAGTTTTTGAAAACTGTACGATAACTG
GAGTCGATTCCTTACTCGATTCCTTACTACTGTAAATACGAAAACTGGACGATAACTGGAGCGAAAAACTGGACGCTAGCGCTGGCCAAAAACAAAAGAT
CGCTCCATATTTAGTGAAAGCGTTCCGAAATAAGTCGTTTGCAGGACCCCTGTTTTCCATGCACCTGCTAGCGCGACGAGTGGAAACGATGCAGAGCTTC
TTCTTCATCGGTGTGCAAGTAGACATTATTTACTGGTCATATAATGATACTGTATTGTAGGACCAAGCGTGGCATAAGCGTGGTAGCAAGTCTGCCTGGA
CGCGAGGTTATTCATGTAAAACTTGACGCAAGTCTGTATTGAGGCAAAAATGAATGTACAAACCAAACCTTGACACTATGGACAGCTTGAAGACACGAGC
TGCTTGAGCTCGGGTATTTGCTTGTTCCTCTACGGGCGCGCGTGCATGAGCGGCGGCGCGGCGTTGGAGGGGGTTTCGTACATCGCGTAGCCGCCAGGGG
TAGCGTTGCCGCGCTGACCGCCGACATTTGACTTGGACCGAACACGGCTGATGTTCCGCTGTCGGGCGTTGCCAGGAGTCCGCGTGTTGCGACTTGCGCG
CTCGGCACGCATGCGAGCCGCGCGATCACGGTCACGCTCAGCTTCAGCCTTGGTGCAGATGATGCCGTTTCTCTTGGTGCCCGCGCCCAGGATAAGTACC
AGGGCGACCACACTGAAGCCTGCAATGGCGTACAGGTACAGGTACTCCTTCTCCATCATCGTGTCGTGCGTGTGCATGTACACGTATCCAAGGTCGGCCA
TGAAGAAGATGGTGAACAGCATCGTCGTCGAGGAGGCCCGGCCACGCGTGTTAAACATGCCGACACAGGCCGACCACGGGGCAGAACTCGTACCCAGACC
CATGAAGAAGTACATGAGCATGACCACGAGGCTGACGTACAAGCCCGATCCTTCCGTGTTGGCCAGGAACTGCGACGTCTCGTTGAA