Description :
From Genome Similarity Track
Location :
contig_69:16447- 19336
Transcript NameFunction/comments
g11622.t1hypothetical protein

Sequence
2889 bases(100 bases per row)
GAGCATCGGCAATGGTCTGCGTAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTACGGCGTCCGCTTGGG
TGCGCCGTGCCATGGACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCGAGGCTAGCCGGCACCCAGCCTCTGGCAGAGCATTGGTGAGTCATG
ACCCCACCTCTGCCAGAACACACGGTATCCGAAAGGATTACCTGGACGCAATGGCGTCCGCCGACTTAAGGAAGTCGTCGGAGTAGTTGCAGCTGCAACA
AGTGTTGAGATACCGTCCACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAAAGCCCAGCGAGTGGAGCTGCAACGCCAGCAGCACC
CACCGCTCCTGATCGTGGCGCCATACAGGTCTCGACTGTATCGGCGCCAGGGGATGTAAGTCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTC
GAGACCGTGGCCAGGGCTGAAGTTGCCGAGAACACCTAACCATGTGCCACACGGAGTCGATGAGATTCCCGACTCTGTCCTTGAGTCACCACCGGCCGTG
GGTAACGAAGAACCACGTCGGGGTAGGCATTGACGACGTCGTCGCCTTCGTAAGCCGAGTCTGTTGAAACAGACTGGAGTCGCCACAAGCGACTCGGAGT
AATCAACGCTCCTCAGGCACGGCCGGCCGAAGATGCAATCACATCTTCGACGGCGAGACCTGTCAGGTGAAGGCGGCGGTCATAAGTTTGACCGCCCTGT
CGGAGGTGTCAGAGTTTTGACACGAGACTGAGTGCAATTTCTCGGTTGGAATCAATGGGTGACTAGTGACGTGGATATGTGCTGATATTTGATTGGCTAC
TGAAAATTTTGAGTACTGGTTATGCGCATTGCGCATGTTGAATGTGGAATTCGGCTGTGTTCCGCGGAGCGGATGCGCTCAGGCTTTAAGATGCCCCCCC
CAGATTTGGAAGGTCAGATTAGGCTCCAAACAGCCTGAAACTGGATCTATGTCTGAATAACCCCGTCCTTAAGCGGGTTAACCCAATGGAGTTGAAAATG
CCTATGTGAATGTATCACATATGGTGTCCCGCCTTGCCTAAAGCCTGAGCGTGTGAATGTCCGTGTACCCGGAGTGCACCGTAAGGCACCAGACGCCAGA
CAAACAAAAAGCCCGTTGAAGAAATGCCGTCTGGACCCTCACAATGAAGTATGATTTTGGTCATGAGACCTTGATCACATTAGATGTCTGAACGCAGATG
TCTGAACGCGGATGTCTGAACGCGGATGTCTGAACGCATGTATTATACGTGCTCAAGACTATCCCGTACTGTGAGGTCGTACACACTGGTTTCAGCTAAA
TGTCCAAGTTGAAGAACCCTGAGCGTGAGTTCGAAGTATCTACGTTCAAGAAATTGGAACCTGAAAATGATGTTCAAGGTCAAGTAACTTGAAAGTAGGT
TTAAAGAACCCACGTTCAGACAACCCAGAACCCAATGCGAGGATTTGACTCCTTGAAGATGGAAAGTGAACCCACGAAGTGACAGCCAGTATACTCAAGC
CAAGTGAAAGTCAGAAGGTCGCCAGGAAGAACACGGGAGAACACAGAAGAACGAAGACAGACAGATACACTTTACGAAGAAGCTAGCGATCGGCTAGCAA
AGATAACAATCAGAGTTCGTTTAACCCCCTACTACGCAAGTCGCTCAAAGTAAGTCTTCTGACAAGCAGGACACGGGTCCGCCGTTCAGTTAAGGGCAGT
TCGGTGCGGGGCTCTCTACAAGATTCAAGCCCAGTTGCGAGGGGATCATTCACGTAAGTATTTGACGTGATCCTTGCATTCCCTTTATTAGTTGGACCCG
CTGCGCGTACGGTAAGGGCGGGGTTTTCATTTCATATTAACAAGGCCTTCTTGGGTGATAGTAGCAGTCATCCCCAGGAATATTTGATAGACTGCGTTTG
AGATAGGATTGTATTGGTGTGTATTATTTCCCTCATCTGAGGGTGGTGCGCGTGTGAAGAAAAGGCTTCAGGATTGACCAGTATCCTGGAATCAGCCTTA
GTTGACTGGTGTTCAGACCCACCGTTCAAGGGTCTATAAGAATAAGTAACGGCTGCGTGTTGTATATAACTCTGTATTTGTATTGGGTATCTGAAAGCGG
TGTTTGTTCCGAGTTCTCGATACCGGTTCCAGACATTGGAGAAGTGCGTTCAGGAAGTGGACGTTACGCTTAGCATTTCCAAGGCCTATTTGTATTTGAC
AACTCACTGTGGTGATATATCCGGGCTTCCTCCGAAGCAATCGACGCCGATAGGGATTACACAAGGTGCCACGCCACTCTCAATCACGGTTTCAAGGAAC
CGCGTTCAGGGTTTACACCCCCCAGGTTTAAGTTTCAGGACTAAGTCTAGGCTACCGCTATACACTTGGGCGAGAAAGTTTCATCGACTTCGTCACAGTT
TCCCTTTAGGGAATGTCACTGCACGACTTCCTGGTCAGCCTGAAGGCTGAGGAGATGGTACTCCTGTAACCGGAGACCTCTCCTGAAGAGTTGAACTCTT
TTTCTGTTATGGACAGGAACGTCCTGGAAGAATTCCGTTGACGTAGTTACGCATAACTACGTCAACAGGTCGCAAGACCATGTCCATCGCGGGTAACCCT
CGCGGACCGTCAAAGGCTTAGCCGATGGACAGGGCGTCTTGCCCGGCATGTGTGGCTGCGCTATACCACAGCGGTCATCGCCGAGAAGTCGTCGCGCCGT
ACGGCCTTCGACTTCAGTAGTGCCGTGTGGCACTACCGGACCGGTGGTTTAAGTCCACGGCCGAGATCGTGGCCAGCTGGAGGTTGCTA