Description :
From Genome Similarity Track
Location :
contig_57:164418- 168092
Transcript NameFunction/comments
g8912.t1hypothetical protein
g8913.t1hypothetical protein PHYSODRAFT_531481

Sequence
3674 bases(100 bases per row)
CTCGATGGGCCCCGCGTCTACCCCTTCGGCTCCCAGCTGCAGATCTTGAGCTCGCGGGCACTATTGCACCGCGAACGCACGGACTCTGGCAGGTTCACGC
TGCTGGACGACGACGGGAACGAGGTGGACGAACACGCGCTGTGGGAGCTCGAGCGAGAGGACAGACTCAAGGCCAAGAGCCTCGAGCTGGACGACGACGA
CCTCGCTGAGCTCGCCCATGACGAGGTGAGCATGGTGCAGGCCATTTCCGTCATCCGCACGGAGAAGATCCAGCTGCAGGAGTTCTTCCTGCAGGCCTTC
CGAGAGGAACAGGCTCGCATGTCGAACATTACGGGCCCGGTGCTGCAGCAGGTGCACCGCACGGAACTGCCGCAGGCCATGCCTCCTGCAGATCTCGAGC
TGCCGCCGTACTGCGGATACGTGGACTTGCTCAAGGACACGATCCCTTTATGATGCGCAGCTGGCACAAGCGCTGGTTCTACCTGGACTTCCAGGCGGCG
TCGTGCTCATGTACAAGCGCAGCTACTGGAAGAGCCCGCGCGGCGTGGTGGACCTGCGTAATGTTGCTCACATCGAGAAGATGACCAGGGGGACTTCCGC
GTGGAGTTCCACGACACGGGAGCCGACGCGCCGGCCATGATGCTCATGCGCGCCAAGTCCTCTGAGGAGGCGGAGCTGTGGACGAACTTGCTGCGCTTTG
CCAAGCAGGCGTCGCGTGTGTGCACCCGCCTCACAGACACGGTGATGGACAACACCAAGGCGCTGATGAAGAAGGCCAACAAGAAGAACCAGGTGGACAT
CCTGGCCCAGATGCTGCAGAACTCGGCGAACAGCGCACGGTCAAGCAACCTGCGCGCGATCGCCCAGGCCTCGGCATCTGCAGCATCAGCTGTCTCGAAC
AGACGCAGCAATAAACAGAACAGACACCGCCACGCGCTGACGACGTAGGCTCGCGGCACAATCACAAACAAGACACATGGTGGGCCGACCCAAGCAGGCC
GCATCCAACAGACAAGATGACCAAGACGAGAAAAAGCAGAAGACAAGACAAACTGTAAGGGGAGGACCTTCCTCTCTTGCCCAGAAAAACAAGCGGAGCT
CTCTATCTATTCCCGTTCAAGTGTACAAGAGCTTTCAGCGTACTGCCTCGACATGTTCATAGCCAGAAGGCACTTCAACCGACTACTCAACTGCCCACCA
CCACACAACCAACTCGACATGCCCCACGATTGAGCGGCACGTATCCTCGTTCCGCCTATCGCGAAGTTTGTCGCCAAAGCAGAAACAAGGGAAGAATACA
ATATTTTCTGTAGCTGTACGAATGGACCGATCCATTGCGTTTGCTTTTCTCTATTCACTTAGACACCGACGTTAGGACGTTGAGGCAGGCACAGATGTAG
AAGCTGTTCTTGGCGAAGGTCGTAGTCTTCCGCCAACTGCAAGGCACAGCCTTGTACCCTTCGAGCGTCACGGTCTGCTGCTGGATAGTGCCCAGCTCCT
CGTCGCCAGTATAGTGCGGGTCTAGCGTGAGGAAGGCGCAGACTCCTGCATCCGGGTCGTAGTCCACGCCTAGCAGCGTGAATGCCAACTGGCCGCCGCC
CATCATAACTGGAGTCCCCTGTGTCTCGAAGTGATACAGGAGCTCGCGCGCCACGTCGGGCAGCATGGCGCCGCTGGAAACGCTCAGCGAGCGGAACGTC
ACGCCAAAAAGCTCGTCCAGCACGTAACCGACTTCCAGACTGCCGATCCACTCGGTTGAGCCTTGGAATCGTGCGGGCTTGTCCCCCATCTTAACCAAGG
CACTCTGAATTTGCTCATGCGAAAGGAAACGCTGCTGCGTGTAGTGCTGCACGAACAGCCAGGACGACAGAGTCTGCAGCGATCGATACGCGCAGCCCCA
GCCTTTGTCGTTCATACCTTGCTGAAGATAATGGTAGTAGCCATAGAAACCATCCACCAACGCTTGCTGGCCCTGAGATCCAACGCCTGAACTCGGGATG
CCCTCGTGCACGTTATACAGCACGTCACTTGCAGCGAGCCACTCGCCTTGCTGAGCCAACGAGCAGCCACGGGACACACGGAAGAGAGCTTGATCCATAG
GTTGGAGGAACACACGATGAAGTCTCTGGAGCGTTTCCACTTCGTCCATGCTATCATCGCTACTGTGGTCAGCGTTAGTCGAGCTCGAAATCACCATTAA
CGGGAACGCCGCGCCAACCAGTGGGAACTGGTGCGCCACGACGGAAGCCACAGACCCGGGGGCATTGTCTACTTTGCCCACAATATCTGCCAACTGGTCA
TGAAGCTGTTGGCGTAGCAGCGCCAGCGCTTGCGGAACCGACGAGTCCACAGGTACCACGACAAGTGCATCGCAATGCGCATGGAAGCGGCGTCGTGGGT
TCTTCGAGACAGAAGGTGCCGGAATGGTAACCACAGGAGCTGCCACCTCTGCCGAAGCATCCAGTGGCGCGAGGCTTACCAGCAAATCCAAGTTGGCGAT
ATCACCGTACTCCAGCGAGGGCAGGAAACCTACTTTCCCATCTTCCTCTCCAGCTTGCTTGGCATTCTGCTGTGCCTGTCGCGCCGTCCCCTTCTTACTT
TTCTTGCCATTGTTCTTCTTGCCCTTCGTCTCCTCTGCATAGCTCTCAGCTTTGGCAATATGGCCTCCAGTAGCACAGGCTTGGCATCAGGAGACAAGGC
GTCGTCTCCACGCGCATTCAGCACACGGAAGGTCCTGCCTTTTTGCTCTGGACGCCCACCCGCACGTAGAAGCCTTCTTCCTCACGTGTAGCAGCCTGGC
ATCTCTGCAGCTGGTGCAGCAACATACTCTTGTCGCCGAGCACGTGCAGATCCACGGCACAACGCAACGGAGCGAAACCCACCACGCGATGGAAGTCTCG
TGCGTGCAGACACTGCACCACCTCCAGCTCCAGCTCTGCAGTCTTCCCATCCACACAACGGAACAGCCTCGGGGTCTGTTACCAGTTCATACACCAGCAC
AAGCTCTCCGTTGTCCTCCTTAGCTACTTGCAATGCGACAGATTCTGGCCATTGCAGAATGATACAACGTTAGTTTAAATATTGAAAAGGCAGCCAAAAG
ATATGGAATTCGAGCGCACCGAGTTCATTTCCAGGTCTGAAGCTTCACCATGCACCACCGCGAAGCTGCCAATGCGCGAGAGGCCCCCAGGCAAGTGGTG
GTCGAAGGAGTTGCCTGTAGACAGACGGAGCAGCCCCCAGACCGCGATTTGCTGTGTGACGGAGACGTCATCTCCACTGGACGTCACGGACCGCTGCGTG
CCGACGACTGCGCCGCGAGTGAGAATAGAGTAAGAAGAGGCGTCTTCGCTGTCTTCGGCCGCGTCGGGGCCGGCGAAACGCCGCAGGGAACGCAGCAGCG
GCGCCGGGAGGAAGGCCTGCATTGGATTGTATCTGACGTAGAACCGGACGCTGTAATTGGGTTAAAGTTGTTTGCTTTACTGCCAATGAGAGAGCGATGC
CTAGCGTCCAATCGTATGGGCGTCTGCGTTTAATTGGCGCACGAAGGGCCATTATTTCGGCCAACCACTGACCATCAAGTTAGTGACCAACGGGTCATGT
GCAACATTCCTCGTAAGCAGGCATGTCGCTAGTGATGGCGTTGCATGCCCGGCGTGGCCAACACTGCACAACGC