Description :
From Genome Similarity Track
Location :
Scaffold_1473:1644- 6989
Transcript NameFunction/comments
Phyag_g10728hypothetical protein PHYSODRAFT_552363
Phyag_g10729SEC1 family transporter SLY1 putative

Sequence
5345 bases(100 bases per row)
TTTGATGAACGCAACTTGTTGAGCGACGAATGTGCCTCCTTCTGGGTGATGTGGTTGCTCAAGTCTGCAACAAAACGCAGCACTTCGCGCCACTCGTTGG
GCATTTTGTCACGCCTGCGCACCAGCAATCGTTGGAGGGGCGAGGCACGCGGTGTCTGTGTTAATGGGCAGGCATTCGATGCTGCCGACGGCGGCCACAT
GAAGAGAGATGTGCAATTCTGAGGAACAGCGATGGACGTTCGAGATGCATCGCGAGGAGCATCCCAACCAAGACGTGcgaggtgtcgtcgtcctgcaggt
GCACGCGCCAGCAAACCCAGTACGAAGAAACATGTTCCGCGAATGGAAACGAGCGGCGAATCAGTGGCCAGCTTCACGATCATCTCCACAAAATCGTGAG
CGTAATGCGTCAGCAGGTCGTAACCGCGTGGCGTGGCCGAAACGTGACCGAGCGCCCACAGTGCTGCACGCTTTTCAAGTGGAACGCTTGCAGCATCACG
AAGACACGCAAGGAACTCGGGTAAATGTCCAGATGCGTGCAGGATCTGGCAACCAGCACTGGTTTTCGCCAACTCACCGTACAGGTGAACAGGCAGCGGC
ACGGTACGTGGCCGAAGGGGTAGCAATTGCAGTGTAAACTCGACCGACTTGAGCGAAATGCGTTTTACACTGCCATTTGAAGTGTTGGTGCCAGCCGCAG
AGTCCATTTCCACACGGAAGTTCCACACAGCGCGCTCACCAGGAGCGCATAGAGAACACTCTGGTGCCGACAAGTACTGAGGAGAGCGTTGGTCTGGCTG
ACACGAACTCCAATCTTTGTTTTCCTCCTTAGCTGCATCAAGCGATGACGACCCAGTGTCGGCAaagtccagcgacgacatcatTGTCTCTGAGGTACGA
TCCATGCTCCCTCCAGCCGAATTCGATGCCGATCGTGCACGCAGCATTTTCTGTTGCGTATCGCTTGACagtgcagctccaccaccggTAGCTGATCCGG
TTGTGGACACGAACCCTCCATTACTCTGCGGAGGAGGCTTTGTAAATCCGCGCCGGTCCACTGGCTGTGTACCCAAGAACAGACAAGCTTGGAGTGTTTG
TTGTGAATTTACCACAACAGGTTGTGGCATGTTACGCGCGTCCACGACAATTCCTTTAACGCGAATTGAATTCAAGCGAAGTTCGTCATCAATGCCAGTA
GTCTCATCCTCGTCGCGCATTGCACCATCAATGTAAGTTTCCAAGATAAGGTTTGACGGAGGACCACTACCTGGGGGGCCCACAATCTTCACCTCCATGT
TCCACGGCATGCGATACAGCCAGTCCAGTCCCCATAGTGATCGCTGGCTGCTTCCACCACTAGGCGGTTTGAGTCcgacgccgccacctcgttTCATAGG
TACATTCACTGGGATGGGAGTAGGAGAGCACGTTTGCCGCGCGTTCGTTGAGCTACTACTCGACCCCcgctcacgtccagcagcatcacggTGCAAACCA
CGGAAGAGTGCATGCTCCACGGCATGCACGTACGAAATATGCTTCTCACGACGCCAGGCGGCAAGCGTGCGTGGAATCCAGTCGCCTGTATCTCGCAAAA
AATTTAGGCCCTCAGCAAGCGAGAGTGACTTGAGAAGCAAGGACTCAGCTCGCTTGTCCTTGAGCTGAATAAGCTTCATGGGTCGCTTCAGAATCATCGC
TAACAGACATGCCGGTGTCTCGGCGGCCTCTTCCAGCACACTCAGAGCAGCCTTGGctacctcctcctcctgtcCAAGCTGTGTTACCAGTGCATCGATA
CCCCACTTATCAAAATCTGCTACCTCAGAGCGAAGCAACGCGCGCAACAAACAGGTAGCATACAGACGCAGTGGCTTCGAACCCTCCATCATCCAAGATT
GAAGCAACTTCCGAGAACTACCGTCAACGGAGTAGTCCAGGTTGGCTAGAATGAGACGACACAGGAAATCGTGGCCCTTAGTTGTGCCCATGACGTAGAG
TCGTTGGAACAGGTTTGATTGTTCCATCATTTTGAGGCCCTCTTTGCTCGAACTCATCAGTCCCAGTAGCGTGAAATACTCACGCAGCATACGTCGCGAT
ACATAATCAGGCGAGAACATACGCGCCTTAAGCACACCAATGTGCGACTCCACGATAGCAGCTTCTGGGCGCGCCTCCAGTTCTAGCGCGGACGAAATCT
CAGTAAGCAGTTGGCCACGTCGGTCAGtcttcaagaagagcaagccTTCGGGGTGATTCAACAACAGTGTATACATTTGGCAAGCTGGACGCAGATACGG
CACATGGTCTGGGATCCAGTACAGGTTCGAGAAATAACCCTTGTTGCCCTGGTCACAACGGAAGAAACCCGAGAGGCGCTTGAAAAACTTCGTTTTCATA
GCTTCCGATAGTCTCTGCGGATTCGTCAGCGGACCCTCCAGCATTTCTGAAATGATGTCCCAGTTCCAATTTTTGTAGTTCTTGTCCGTCAACACGCGAG
AGCGGTTGTGCAACATATCCTTAAACGTGCTGTCATCCATCTGTGCATCCAATGATTGCTTCAGCTCGAGAACCATCAGCTCTCGCGATGTTAAACTGTC
CTTCAGTAGAGCTGTCGCACTTTTCGTGCCACGTTGTGCAGATGGAGCCGCGATAGCATAGTTAGCAGATCCACTACCCGTGCCGGCGAtaccaccaccg
ccactaGATGACGGAAGACGCACCACCCCTGCAATCTGCTGGAGAGCCAACAGATTAGACGGTCGATTCGtgtcgcgcagcagctcggacgCTAGCTGCA
CACCATTCACACCGCTTCCACCGTACGAGACTAACGATACTCCACGCGTAGCAATGCTGCCTGAATTGGCGCCGACAGCGTTAGCCAGTTCACCTAGCAT
TTCACTTGCTAAAATCGACTTTTCACGTTGTAGACGTTCCAGAAGACTCTTTGCGTGGTCTCCGAGAGACATCGTGGTCGTTGTTGTGAGCGATGTTGAC
GACACTAGTCGCGGAAGTGCAAGCAAAGACGCACAGTGCTGGTCTGGCAGCAGACGCGAGGCCATGCGCAGAATATCAGCTAGCAGATCAATGGCAGGCT
CGGCCAATGCTCGAGACGGACCCGTGCCTAAAGTCACCAGTGCCTCCAAAATGCCACAATGGATCATTGCCAGCAGGATGATCACCGTGTAATTGTCCAG
CAGATTGTGGTTGACTGCAAGTGGCAATTGCTCTGCACTCGACAAACTAACCGGGAGCGCCGGTgtgtccgctgctgcttccgatGCTGACTTGTCGAAG
CTCGTTTTCTTGTAAAAGATCTCGCAAATCGTCGACAACACTGCCTTCTGCACGTCCTCACCCACAGGTCGCACCAACAACTGAATCAACGACTGCAATC
CCTGCGGGTTGCTCGTAAGCACCACCATCCCCGTCCACGACCGCATCATCGTCACAATAGCATTTCGACTGGCCATCCAGCGCTGTCTCCTCTCATTGCC
CGCTGGCAGATCTGTGTCTGTAAACGGCGCCAACAGCACCTGCGAATCCACGAAAGGCTCAATAAACTTGCGCGTCGACGGCTCATTCAGGataagcagc
agcgtcatcaGCAACGAATCAGCCAGGTCCTGGAACGACGGCTCCAAAATGGCGTCCACCAGGATCTTTGTGCCATTAGCTTCAGCAACCACCTCCAcat
tcagcagcgccagttcCCTCAGCGTCTCGAGACACACTCGTCTCATATTGTCGTCCTTGTGTCCTGCCACAGCCGTCAACGAGCACACTAGACCCGTGGG
CATTTGTGCCGCATCGATCTCCATCACCCTCCTCACCACTTTTAGAGCTTGCACCCTCTCCGCCAAATGTTTCTGCTCTCGTTCCAACGACCGCACCACG
AACACCGGCAGATTAAGATCCACGAAgtgtttgatgctgttgctgctgctgattgcgTAACGCAATGCACGCAACGCCCCCGCGCGCGTGGACGTATCCG
AGTCTGTCACCAGTCTCCGCATGGCCTTCATCAGCCTCTCCATAGGGAAgctgtccagcagcagcgggtcattcttcagctcctgcaatAGTTCAGTAGT
AAGTGTATACATTAGCGCAACTTGTAGTATGTTATTGGGGGGAatcgttctcgtcgtacgTAGCAGATGCGGCCTGTGCTGTCGAGCTTGGACTTGCGAT
CCAGATTGCTGCGCTCGATGAGTGTACAGATGGCGGCCAAGCTGCCATCCCCGCGCGGAGCGGAGCCTCTCCGTTGCGACGCCATGCTGGGGCGGTAGGT
TCACCCAGCCGAAGGGGGAAGCACACCCGAAGTGTTCGTCTGACTTTTGCAGCGTTGTGTGGTACATTGAAATGCAAAATTCAATGTACTGCACCACGCT
GCAAAAGTGTACACTTTTGCAATTCAATGTACCACTCCAAGTGGAGGATGGAGTGCCTGCTGTGGCCTGGACATTGCAGGAGCAGAGAGAGGATACATGA
TCACGTGGAGGCTCTTGCTTTCGGGATATTTGCCCCTAGGTTTGAGGTGGTTTATGTGCATGAACCAGTTACACGAAGGACCTCCGTACATCCTCTTGTT
CATCACCAGATATCTCCTGCGTCGAGCGCCTGGAACCTGAGATGTGCACTCGGAGGCGTCCACGATGCATGAGGCGCTTTCCTTCAGTGCGTTCCTGCTT
CaggacagcagcatctcgggAGCCTAGACATGCATGACATCGCGGACCAGATCATTCGCGGCAGCTCGTAGGAGCAGACGAAGCGTCTGACGATCGGGTG
GAGCTGACTGCTCCGCCGAGCATTTTGTTTTTGGACGAGTGGCCGTGATGCTCACTCGGCCAAGGCGATCACGGACGGTGTGGTGTGTGTAAAGTGACCG
ACAATGGGCACACGATCGTTtgcacgatccaccagctTTCGTCGGATGTGTTTTCCTGTTTGATCACTTGGTTCTGCTGAAGCGCCACATCCCGTCGTAT
TCtatgctggagcagaagctcaTCGATGGCTCCCATGTTGACAAGGCTGAAGTACTGCAGCTATTGGCGAACGCGGAAATGGGCACATTGGCCGATAAGA
TGCGGCTACAAATGATTTACTTCCTGTCGAGTGGTGCGAGTGGTGCTGGAATGACAGAGTTTGAAAACGCCTACCACCATTGCGCTGGTGGTTCCGAGCA
GACGGAAGCGTATGCAGGCATGGAAGTTTCTCCAAAAGCATTCGGCTTTCCGAAGACGTACCAGTGTCGGGGCTAGTCTACAGACTGAGCGTGGTGCAGG
ACCGGATGGAGGTGTGAATATGAGCAAGTTCAAGGGCTTGGCCCA