Description :
From Genome Similarity Track
Location :
Scaffold_58:164392- 167266
Transcript NameFunction/comments
Phyca_LT1534553991nardilysin, putative

Sequence
2874 bases(100 bases per row)
tggaggcgtccaagtcgcccaatgaccagaagaaatacaggctactgacactacccaacgctctacaggtgcttctcatctccacggccgaggtggccca
tgtagtggctgctgtggcccgcgagagcgagagccagcagagccaacatgacgacgacgactttagcggtgaggacagcgactttagtgagagcgaagag
gacgacggcagcagcttcggcgacagtgaagaagagagcgacggtccgcccagtcgaagggctggcgcttgtctaacggtaggtgttggaagcttcgcag
aacctgaagaactgcctggactagcccattatctggagcacatgctgttcatgggcagccggaagtacccagatgagaacgagtttgaggcctttctgag
cgcccacggaggttatagtaacggagctacggataatgaagtgaccagctacacgttcgaagtgggtccagcgcatttagcgccggctcttgacatgttt
gcgcacttcttcatatcgccgctgcttaaggctgaagctatggagagggaactgtcagctatcgagtctgaattcagccaagctactcagaatgaccgga
tccgcacgcaacaagtgctgtgcgatgtgtcgcctgaaagtcacccgtaccatcgcttcagctgggggaacaagaagagtctgcaggagatgccggaaaa
gaccggcatggatgtccgcaagcagattctagagttctacgagaagtactactcggccaacatcatgaaactggtggtctgtggtgaaaacacactggat
gaactggagcagtgggtgaccgagtcgtttagcgcgatcccgaataagcaggtggcagttccgtcttttgagtcagctggaccgccgttcggggctgtag
gtgctggcgcaccgttcctctgcaaaattgtacctgtccgggatattcacacgctgcatcttgactggatgatccccccagttcttggtcagcaccacca
aaaaccggcagactacatcgctagtctcctcggccatgaaagcgaaggatctgtcctgtcacatgtaggttaactacctttcgtacgtatctacgagacc
gatactcatgtgtttaatgtatttgcagttgaaggagcggggctggatctctgcggtgactgcaggggtaacagacacagatggctacgactgtggaacc
tatgcagccaagtttgatattacgatgaagctcactcctgagggcatttcccactgggaggaaattgtgcacgcagtctttgaatacctgcacatgctca
gggtaaatggctgcccggaatgggtctttgacgagctggcggcgctggccgacatttcgttccgcttccaagaagaggatagtgctgtcgaaaagtgtga
agaactgggcgaagttatgcaggtaagccctcgttgtgtgagctttgcacatatccgtcctcgtatgcgatctaactgttctgcacgcgtttgctattaa
agtctatgttcaaggtcgcaccaggagatatcttgcgctatgacctgtttaaaggcgctttcaagaaagagctgaccgaggaggtgctaagccacttgac
tgctgagtccgtttgtgtgacgattgtttcacaaacgtttgaggattcgcctgagtttcaagcgcaggtatgaaacgaaagatttcactgctgttggtca
atctttgtaatgaatattgactggctcactgtgattataggtccgtgaagaggaatggtttggcgtcaaatattcccgagaaaacattacggatgcatct
attcttcgatggaaaagcgcaggaattaaccccaagctgcatctgcctcggccaaaccagtttattcctcgagatttctcgcttgtgaactctacaggcg
ttgatgacttagtgtgtgagaagacgaccttcggcaagctttggtacaagccggatcgcgtatttgctacacctcgcgctcacgttgcgctcctgcttca
cttgcccaatgtggtggccagtgcaaacaattgggcccacacccagctgtacgtgaagcttgttcgggatgtgctcaatgagtacgcctaccacgccaat
gtggctgaacttatgtactcacttcatgtgaaggagtctggtctggagctgatctttggtggattcaacgacaagctccaccttcttgtcgaagtggtcg
ttgcggctgtgtttgggactgaaattaacgacgcgcgtttcgaagtgatgcgagaagagttgatgcgtgaatcaaagaatgccatcacgaaggtggctca
gaaagcaaagtatcttcggttgcaactgctggagaagcggtcatttccactggaggagtgtttggactcgattgagactgccaccgtggattcacttaag
aagttcgtctccaatcagctgtgggcaggcaaagcatggctagcgagttttgcgcatggaaatatctcccattcagcagcggtgcaggtaattgccaatg
tggaatcgcagctgcagcgcgtttcttcgccgctcctgttacgagacctcccccgacgccttatcaatgctattccacagactccgatgggatttctact
gaaggagcgcagtgagaacaagactgagaccaacactcaagttgagttgtattaccagatcggtcccttgactctacgcagtttggcgtacgcggacttg
ctgcaccagttgatggaggagccactatttgacactctgcgtacgaaacaggagctggggtacgatgtctcgtgcaccgttcgcgtaaccaatggcattc
tgggctttggtgtgatggtgcagtcgtctttgttcgctgctgagtacatttctgcgtgtgtggatcgttttatg