Description :
From Genome Similarity Track
Location :
Scaffold_16:164368- 167278
Sequence
2910 bases(100 bases per row)
TCAGCTCGATCCGAAAAGGGACGAGGAGAGCGGTGCCCCCATTAATGGTCATGCAGTCACCCTCACTAATGCAGTGTTGTGTCCCCCCTTTGTCCAGCCA
CCATATTTGCTGACAGCGCAGTGACGGACTCCTTGCAGAGTCGAGTGTAGGTCTTGAACGCGTCCGATGCCCATCGGCCGTGAAACTGAATCGTCAGTGC
ATCCACGCCGGAGCGGTACATATGGGTCGCCCCGCCTGCGCGAAGGGAGTGTGTACTAAAGTGGCGAGGGTTCTTGCCGGTGCGGACGGCAGCACGCTTT
ATAGCTTGGGACTAATCTTCAGCTGAAACGCAGGCTGGGACTCCTCGGTGTGATATGAACACCGCGGCTGGAATGCTAGCCGGAAGACCTTTCCTTGCTT
GAAGAAGTACAAGAGCTCCGAAAACAGGGCAAAGGAAGTGATGGCCAGAGCGTGAGAGCATTCTTGTAGTAGGGGTTCCGCCTTGGTTTGTCTTCGAACC
GATCAACCGTATCCACACACCCTGAGCTTGCGATGGATCCTGGGTTGGCCTGCCCGTCGCATCGACAGTTATAATGTCTTCAGCTCGAAGTGCAAACCAC
TTGAAAGAACCTCCTCGGATTGACACGATCTCCGATCGACGTAGGAGGAAGAAGTACGCCAAGCACATCACCCCCCATAAAGCTTGCTCACGAGGTGTAG
CCATCGTCAAGCTGCGAAAGCAGGCTTCCAGAATGTCGAGTGAAACCGGTTCCTTACGAAGCCGCGGTGTATCGAGACGGCTGATACCTTTGAGGAGCAT
GCGGATGTCTGGGTGTGCGATCGGGAAGTCGTAACCGAAAGCGGCGAAAAAGTGTCGTACGCCTTGAAGAGCCGCTGTAATGGAATCACTACGGATTGGA
CCGCCGGATCCGAAGCCGAACTGAAAACCGTGGAGAACGAAATCTGAAATATACTGCACTTTTCGATGAATGGAGACGTCGAGAAGATATGGGTGAGCGC
CTCTGCGTGAGATCCAACTGGTCCACTTGCCTAGGGATCGACTGTACTGCACAAATGTGGAGTCGGCAACGGAGTGCGCGCGGAGATACACTGCCAGACG
CTGGTTAGGCCTTGTATATCCACCGGCGGGGACACCTGCAACCAGCCGGAAGTTAGCGACGTAAAAAGATCCACAAACGACGCGTTAGCGGTAAGTCGGG
AGCCAGCATCTGCTCGGACGTTGTCTGCGCCGGGTATGTGGGACGCAGAGAACCGGAGTCGAAAGGTTGATTCCCACCAACTTAGCAGGCGAATAAGAAC
TTGAGCCCTGGGATTGCGAGATGCCAATTTGTTCTGCCACGCGACGGCAGATGTGTTGTCGATGCGGAAGTGTACGTGCCGCGGCCTCCCAGTAATGCGA
GTGTTTGAAGCCCACCTTGCGCCCCATGTATGCACAGCGAAAGCACACGAGAGAAGCTCGCGGAAGTTGATGTCAAAACCGTTGGTCTCTCCGTTGTTGA
ACGCCGCGATGAGATCACGCTCGGACGGAGTGAATTGGTACGTCAGTGCCTCCTTCGCGGATATGTCAAGTGCGCAGAGACCGAAATCTGAAGCATCCGT
TTCAACCATAATGTCCGGAGGCGGAAGTGCGCTGAAATACGCTAGCGAAACGCCGTTCAGGTGAGGGGTGTGCAAAATCATCCACCACCACAGTAGGTCA
TCCTTCATTGTAGCAGTCACGGGGACGCTCTGGAAGCGGTTGAGCCGAGCCTCGCGGACCCGTAGGCGCTGTAAAAATGGTCTAGCGGCCCGAATACATG
TTGCCACATGGCGTAGACTTCCGAGCAGGGACCGGTACCCCTTGCGGGTGAGTGAACTTGCGACGTAGGCGGAAGCTACGATTTTGCGGGCTTTGTCGAT
TTTCGCTGAAGGCATGGCAACAATTTCTGCGATTGTATCGAACTCGAGTCCTAGAACGCGCCGGCGCGTCTTCCAGGGAGTAAACTTCTCAGTGTTGATA
GCATCGACACCCAGGACGGCGACCATGGCAAAACGGAGAGAACGATCCATGTCAACGCATGTGGTGTCAATGTCGGCAGCCACGTTAATGTGATCGTCTA
CCCAGTGATAGTTGAAGAAGCCACCAGGAGAAACTGCATTCGAATGACCGCCGTGAACATGAGAGATCGCTCCGCCAAATATCTCGTAAAAGCCGGGAGA
CCCCGTCCATCCGAAAGGTGCTGATAACTCGACGATCAATGCGTTTTCTTCTTTGATAAGACCGGCGAACAAGTACACACTGTTGCTGTGGATGCTGATG
TGGCGGAAGGCAGATGCCACGTCACCTGCCATTACACGGACAGCCGCACTTGGAAAATCTTCTTTCGTTTTCAAAATTTCTTGCGCTACGGCATCGCAGT
GGGCGTAGTCCGGCTTAGTAATGCTGTTTTGGTCCGTGCAGTCGTTGATCGAAGTACCATCCGGGTAGGATAAGTCGTGGATTGTGCGACCCGACGTGTT
GGCATCTTCGCTTCCCTTGTCGACGACGCCGAACGGACTTATAATTACTTCGGGCCACTGCTCAAGCAGATCAATGTCAAGAACCAGGCATCTCCAGGCG
TCTTGCTCTTTCCGGATATTCTTGCGCAAAATGTTGACGCGTTCTTGAGCAGAGCCATGATTTGGTGGCCGAACCACTTGTCTGGGTGGAGCCGCCCTTA
ACTTGACTTCGACTCCTTCACAAGCAATCTTGTTAAGTTAATTTAAGTGCTCGTAACCTTCACACAACTTGTTTAGGACCGCCGGAACGATGTTCTTGTT
TGGGCGATAGTCCTCCACTGTTTGGCCTCGAATTAACTCTACGAATGCAAGTAGCGGGAGCGCCGACCGGCGTGCAAGGTCCGATAGAGCGTGCTGCAAT
GGTTGGTTAA