Description :
From Genome Similarity Track
Location :
Scaffold_116:16436- 18748
Sequence
2312 bases(100 bases per row)
GCAGCTCCAACTCATAGAAAAGCTCTACTAATCGTCGCTTGATCAGGAATGGTCTATGTGATCGGTGAGCCAGATTCTTCTTTAGTCCTTGCTTCACCTT
CTCCATGAACAACCACACTTGGTCTTCTTCTTCGAACCCAGTCTCAAGAGGTGCGTCAACCCCTTCATCCTGTCGACTTGCTTCCGTAGTGGGTTCTAGT
TTTGTATGTTCTTGAAAGGCCTTGTCGTTCGGCTGGAACTGAGTCGTTCGTTGTGTTCTTTTTCTCGTCGCGCCTTTGCATCCACTTGATAATTTTTTGC
GAGCTTGAGCGCGATCTACCGTTGTATATTCAACTCACGGCGACACATGAATGGATTTGTACGTGTTTATTGACTTACCTATCCTTTCTGAAGGTCGTTG
AATATAATCGGTCATTGCCTTTAGTATATAGTGAGAATCCCAGCCATGCACCAAATGAAACGGAGTCTCCGTTCCTGTCATGTCTCTAGAGTTGAAGATA
ACATGGACAAGCTTCTCGGCGATGTCGTCTAAATCCGCTTAAGCAGATCTCAGACGTACATGCGCGCAGTCTGGATTATTCTCTTCGCGTTAGATTCTTG
TTGTCCGTTCGCTTGCGATCGGCAGCTCAGTGTAGCGCTCTTGTTCGACCCCATCATCTCGGCGAAAGTCAGGAAACTTCGCTCATAAACCTCGGGTCTT
TGTCATGACGTATGAGACTGGAAGCTCCGTAGCGACGGAAGATGTTCTATCCGAATGATTTCGCGACCTCGAGTAACCCTGTAGTACTTCATGGCGTTAG
CTACCACGACTCCCTAAATATAAGAATAGTAACAACGCCGTGTTTCCTCGTTGAGTCACAGGTAGTGGGATGACAAAGTCCATTGACACAACCTGATATG
GTTGATCGGACACCACGTTGCCCGGTGAATACCTTTTTAAGTGGGACTTGCTTTTGCTGGTACTGCAATCTTCGCATTCCTGTACGTGTTTCGTCACTTC
GGCGTAGTAGTCGGTGTTTACGCGATGGTTGGTTCGCTCGATCCCTTGATGTCCGCCTTCAACTGAGTGATAGCTGTTCGGCACAATTTCGTCGATCGTT
GTAGTCAGAACCACTAGCCATATCTTTGTATCTTCTTCCGGTGACTCGCTCGACTCGAGACGTCGTCCTAGGAAGAAGATCATACTGTCTTCGCTCAGTA
CGAATCGATCAGAAATTTTCCCTGCGTTGCTGACTTGCCAATGGGGCATCTTGTCATACTCTCTTCTGAGGAACGTCTTATGTGTTGCCCACTTCTCTTC
CTCATCTTGGGCAAACGAAATTCTTTTCCTTTGCTCAGCTTGCACGATCACTGGATCAGTGTCTACTGGGCTCGGTGGTCCTCAACTTTTGGTGCCTTTG
TCAGTTTAGTCGATACTTGCCGAATCTTAGATCGTCAATTGGTCATTTCGAATTCGTAGCCTCTATCTGTCTCTCCGAGCAGCTTAAGCGCTTGCTGTCT
CGACGATCTTCCATACCGCTAGGCGTGTGACACAGCTATTGTGTCGGTGGATCAGCAAACCGGACCTTTCGAGTAGCACTCCGCGTTGTGGTTGCTATTG
CAGGTGTTTCACTCTTTTCGCTCACCAAATTGATCTCGACGAGCAATTTCTCTTGTATGCGTTTAAAGCTTGCAGCTCACTCATTCGTGCTTAATCTTCA
ATTACTTGTCCCACCTTGGACTCTAGTACCCCTGTAGCCTGCGTACCCGCTGCTGCGTTATAACATCGCACGACATGCTGGTAACGGACGGAATTGAATC
GCTCGACCAAAGTCCTATGTTACGCTGGCTTCACTTGTAACGAATCCTTCTTGCACGCGATCACCCCTGTGGATTGCTAAATCGCGAGCCTGGACTCGCC
AGCAATGATCAGGTTGGTCACGTTGTGATCCAATGCTGCTTGTGTGTTCCGATTTATCCCGTTGTACTCAGCAATATTGCCGTAGTCGCCGACAGGTAAG
CGCTCGCAGCGATCATAATGGTCCATTTACGTAATTTCCACAGTATCCACGAACAACTATCATAACCGCCATGCTTTTCTGTCCTAGCCGATTCGCGAAC
GATAGCACTAAGCCAACGAATGTCGCAAAGGATTGTGCGTAGAGCAACTCTAGGTCCAACCGGACACTCCCCGAAGGCTTTGAAGGTAAAGCGATATGCC
GGAGTGACTCGTCGAAGCCTACGGTAGGCGTGATTGAAGCATGCAGCAATTGAGCAAAGTCGACGTCGCGCTATCTCACCTCTTTTATATTCAAGTGATA
AGGGGATAAAGC