Description :
From Genome Similarity Track
Location :
Scaffold_124:164335- 167471
Sequence
3136 bases(100 bases per row)
CTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCGGGCAAACTCATCCACTTGGCGCAAGCTAGAGATCTTGGCA
ACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACC
TAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCA
AACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGG
GATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGC
CCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTTCTGTCTTCGCCGTTCGATCGTTGGAC
GCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTC
GAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCAC
TTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGC
AGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGC
GAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCC
CAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTG
ACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGG
ACGATCCACCTGCCCCGGTTGTGGCTGTTGCTACCACTGCTGACGAAGTGAATGGGACATCCAGATCATCTGGGTCGAACTCATCATGGGAGCTGTCTCC
CTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGAAACCGACTC
ATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAATAGCCTGTGGCCGTCTGGCCCACTGGGCGAGACCGGATCCGTGAGGCGATTA
CCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGCCGGATCTGGCTCGACTCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGACACCGGATCCATAGTG
CGCGAACTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATTCTCTGCGTCGA
ACACACCAGCTACGATGCCTGACTCCGAAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGTCGTTTTCGTTGGTGCTCTCACCGGTTCCCT
TGGATCTTCGATCTGACGTGGATTCAGGATCTGCATGACCGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTG
TCTGACCAGCTTGACCTGGATCCAGCTTGGTCCTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTAGTTTTCGTCTTCTTTCTCGTTT
CTTCGACTAGCGGGGTTGGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGG
ATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGATTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCC
GTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGC
TCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAA
ATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAGCTTTCCTCACCT
TGTGTACCCGTCGGTAGGGTGGGATCTTGCTCTCTCGGTAACTTCCGAGGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTG
GAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGC
CGTAGGGTTGCCTTGCGGGTGTGCTCCCTTGCCTTTGTAGTTTCCTTTGCGTCGTACTTGCTGCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCTCTA
GGGTGTAACCGATTAAGTAGTAAATTCGGTTAACCT