Description :
From Genome Similarity Track
Location :
Scaffold_43:164315- 165397
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14445hypothetical protein

Sequence
1082 bases(100 bases per row)
GCGAGTATCGCCTTCCGCTGAACTTGTGGTTCCGGGAGATTAATATTGTCATCGCCTCGAGGTTGCTCGAGGCGCCATCGGCTAAAGTCAATTTTCTTCT
CTCCCGGCTGTCCGGAAAGGCTAATGAATGGGCACTCGGCAAGCTGGTTGTCGACACTAACGCCTTTCCCACCCTGGAAGCGCTCCTGGGCGATCTTCGG
CTCGCTTTCGAGCTGCCTCAAGATGAATCCCGCGTTCGAGCGGACTTCTTTGCCCTTCGGCAAGGCTCGATGTCTATGCGCGACTACGTCCAGAAGACGC
GACACCTCGCGTCGTGTATCGTAACCAAGCCCATCGACATGGCCTCTCAGGTCTACGTCTTCGTGTTCGGCATGCGTGAGGGAATGACACGTTACTGCCT
CACCCGAGCCGAGCCTTCTTTTCTTGAAGAAGCATTTGCCCTTGTGCTCCGCAAGGACTACGTGGTGGTATCATCTTACGCCTGTGCGCTATCTGCGTTC
GCTCGAGAGACGGTTCCGAGCCCATGGAGATCGACGCAATCGATGCGTCGAACAGTCGCCAACGCAATGGTTATCGCGGGGTACACCGGTCGCTTCCTTA
CCTGCTTCCGTTGACGGAAGCCTGGTCATCGCGCGGGCGCGCCCGTTCCGGTTCTCGCACATGTCGGTGTCGAAACTGCTCCTGTCGTTCAGCCAAATAA
AAAAAATAGTCAGGGTCAGTTGGTGGGGGGCGCCGTACTGGCTGGAATGAAGGTCCCCCCCCCCCCGTGGCAACCCAACCTTCTATCCCTCGTGTGCTTG
AAGTACACTTTAATGCCACCACCACACCGAGCGATTCGAGATTGATCATTGTCAGTCTTCACGTCGCCGGTGCCCGGCAACCACTGTGGACATTCCTGGA
CTCAAGAGCTTCCGTGCGTCGTGTCTGTCGGTACTCTCATCGGCAATCAGCGTCCGTGATGGTCGCGGCGAGGTTTCCGTCAAGCTCGCCGATGGCAAGC
CGCGCCACGTGGCAAGGCGTGAGATAACACTGTCGTACACGTTTGACAGCTTCCGCAGCAAGGACGACTTCCTTGTGATTGA