Description :
From Genome Similarity Track
Location :
scaffold_6:164308- 165794
Transcript NameFunction/comments
g426.t1 hypothetical protein PHYSODRAFT_315958

Sequence
1486 bases(100 bases per row)
ACTCGGCCGACTGGGTCGCCGACCACGAGCGTAACCTTTGCTATGTCTGCACCAGACCTTTCGGCACTTTCCGGCGCAAACACCACTGCCGCATGGTGAG
CTTTCTCGTTTGTATCAACACTGCTACGAATAGCTTTCTGACGTTTTTGCTTGTTGCCTGTCTACTGCAGTGCGGCGAGGTGGTTTGCAAGAACTGCACG
CTCTACAAGGACGCCAACGTTGACCCGACGCTCGAGCCCACCCGTGTCCGCGTGTGCATGTCCTGCGTGATCAACAATTCAAACCAGCGCCGATCAATCG
ACGCTTCAGCGCCACATCTTAGTGCGACGTCGGAGGCGTCTCGCGTGTGGTTGCAGAACCACCTGCAGTCGCCTGCATCAGGTCCTTCTTCTGAACCGGA
CAGCGAAGAGCTGCTTCGTTCACTCACACCCAAGGCACGCCAACACTTGGAGCTCAGAGACGGCCACTTCAACGCCGAGGGCGAATCCAAAAGCAGTCGC
AAGAGAAACCTTCAGGCTGAGCAGCAAAGCAACGAGCCGTCGCCCGAGTGGGCCCACCCATGGCCCCGACCACCAGTTAGCGCCGACGAAAAAGCTCGTC
TCCAAGCCTTGCATGCGCTAAACATCCTCGACTCCGAGTCGGAGAAGCCTTTCGACATGATCTGCGACCTGGCCAAGGCGCGTTTGTCGTGTCCGATGGC
TGCGGTGAGTTTCTTGGACGAGCACCGTCAGTGGTTCAAGGCTAGTGTGGGGCTAGCACATAAGATGATCCCGCGCAAGATCGCTTTCTGCGCCTACACA
GTGCACACGCTCGAGCCGATGGTTGTGCTTGATACACTTCAGGACGACCGGTTCCAAAAGAACCCACTCGTTTCGGGTGCCGCCGGTGTTCGCTTCTACG
CGGCGGCCCCGATAATTGACCCGAACTCGGGACATGCCATCGGAAGTGTCTTCGTTCTGGACACACGTCCCCGGGAGGCTTGCGATATCTCCATTTTGGA
GCGTCTAGCGTTGGCCGCTGCTGAAAATCTCCCCGCAGTTGAACTGCAGGCAGATAACGAACTCAACATCGAGCTAGATAACTATGCGCACGACGTCACT
GATCTGGTCCAAGTTGCCGCTCAGAATGGACTCCAAAGCTTTGGCAGGGGGAAGATTGCAATGCCGATGTCTCCATCAACTTCAGCTACGACCTCGTCCA
TGTCATCATTTGGGTCGTCGTCAGCGCACTCGTCGCTATCGCCACAGAAAGGAGATAACAACGACAGCAGTGAGAGCGAGTCAATGGCCATGACGCAGCT
TTCCATGGGAACAACCTCGGCGGGTGAGCAGATGGAGGTGCTTCTCATGCGTCTCCTGACGCAAAATACTGAGACGCAGCAGCAATTGGCAGTGCAGCAG
ATTTCGCTCAACACGAAGCTGGGGCAGCATACGGCACAGATCAACCAACTCATGGTCGATTTCGCCCGAATGGAAGCAAAAGTCGA