Description :
From Genome Similarity Track
Location :
Scaffold_739:1643- 4155
Sequence
2512 bases(100 bases per row)
CAGCAGCTTGTAGCCTTTCGTGTTTGTAGAGTAGCCGAGGAAAAGAGCCAACTCAGCACGCGGGTCGAGTTTGTCTCGGGTACAAGTCCTTTCCTTCGGA
ATGTGCGAGTGCATCAAGCAACCCCAGGTTAGCAGGTACCGTAGCGAAGGTTTCTTGTCGTATAGAGCTTTAAAAGGGGACTTACCATCCAGCTCAGCTG
TAGGTAGCAAGATCACCGTGTCCACGCCATGGTGGAGAGCTTCTCCCCACAACAAATCGGTCTGACTTGCAGCATGTAGCACAGCACGTAGTCGCGGTAG
TACCGGCCTGTTCGCTCGCTCAACAATGGCATTTTCCTCAGGAGAATAAGAGTTGGTGCTCTCAATCTGGATGCCAAGTTCTTCGCAGAAGTCTTTTAAT
CGGCTGCTCAGGAATTCACCTCCTTGGTCTGAATGCAGGGTGACCACCGTGCGCGACTGCCTCTTGAACTTATTGTTAAGTCTCAGAATCAAAGTCTTAA
TCTTGTCCTCTGCATCGATCTTGTTCGCAAGTAGATAGCACCACTTGTATCGCGTAGCTTCGTCCACTAGTTTCACCTGTGATCGTCTCGTCGCCGACCG
AAACAAAGATCTACAGAGAGCTTCTCCAGCGGGTGTTTATGACGCTCATGATTACGTTTGTAGGACATGCGCTTAAGCTTAACAGTAATGCAGGGTACAC
AGTCGTAAGCATCTTGTGGAGGTAGGCGAGAACTGTTCTGCATCCGCCGCAGGCGCAGGAGGCTTTGTTTTCAGCTCATCACGTAGCTGTTTTGTCGCTT
GTTCACCAAGAACATGGCGAACTTCATCGAACGTAAAGTCAGCAGCAGCGGATTGAGGTTGTTGGTGCGCAGCACCATCCATACGGTTCGTGAATACACC
ACCTGAGAAAGCTTGTACTCGTTGGTTTCTTTCCTGGTTTCCAGCAGCTTGCTGGCTCGCTCTTTTGCATTCTCTGTCGCCCTTACAATGTCCCTTCTGT
CCACACGTCTTGCACGTCGGGTTTTTCTTCTTCCTAGCCATAACAGAAGTCCTCGAGCATGTAGACGAGCTGCTTGACACGGAGAGACTGTGGTTGCCAT
CGTATCTGCCACCTCGCTGGCGTGGCTGTCTCCCGTTTCCACTCTGTTGAGTGAAGTTAACGTGTAGTTAAGGCCGTCCGCTGGATAGCCCTTTTCCACC
GCTAGATGCACCGCTGCTGGCAGCTGCGCCATGTTGCTCGCGGGCATGGCCGTCATCTCGGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNN