Description :
From Genome Similarity Track
Location :
scaffold_47:1643- 18439
Transcript NameFunction/comments
Plaha_PHALS_00470hypothetical protein
Plaha_PHALS_00471NAD(P)-binding domain
Plaha_PHALS_00472coatomer subunit
Plaha_PHALS_00473er degradation-enhancing alpha-mannosidase-like protein
Plaha_PHALS_00474ATPase%2C vacuolar ER assembly factor%2C Vma12

Sequence
16796 bases(100 bases per row)
gctttagtacgtAGAAGTAGCGGAATACATTCCGCTACACTAGTACTTGTTCTTTAagagcgtaaggtcggtgaccttatctTAACTTCctataagcaaa
gagctacggcagccccgctgcacaatcAATGATGCCTCAGCTAACTTTTTTAGCCGTGAATACTTCGCGGCTTACACATCGACTACCCTTTGACATAGCA
CCACCTGTGCCAAGTTTGATGCAACGATAGTTTCGTAGAAAATGATGTGATGATGCGCTGGCTACAGCTTGGAACTTCTCCCCACTCACAGATGCGTCAG
CGCGCTGAACGATGATGTAGATAATCTACTGTGAAGGAGGCATGAAGCAAGGTATAGAAGCTACCACACGCTCATATACATCCCCGATTTTGACCGCAAG
GCCAGATCTGCTTCGGCATCGAACACTAAGTCAAGCATGGTAAAGCCCAGAGGTTTAGAAATAGGCGATAGGCGGTGACTAAACCAAGCTATTACACAAG
ACAAGAATTTGTAAGAAAGCGCAATTTACAACAGTCTAAcatacacaacacacacgcttgtttGACGAGAAAGCGATTCCTGACATGGTGAAAGAAGGAC
AGTCTCAATTTGGAAGAATAAAAAACGAATTAAGGgctagatttttttttaaattagaATGATTCAATAATTCCGAGTCAATATGGTAAAAATCAATGGC
TTCTAGAGGTTATATAAATGATGCCTTCTGCTCCCATAAATGCGATTCATACAATTAAGAACTTACTGAGGATGAAGCTCAACCTGAAGTGATGCAAAAT
CTTAGTCATACGATGCTTTAGCTTTGACAAGCTCAGCTATAATGTTTGTGGAAAGTACCCAGAAGAAGTGACTGGATTACGCCACTTACTTTAAAGTTAG
atacacgtcggtctcgtcaccagtacaaatcCCAAAGTGTTAACCAGCATCAAgtatcacacaaaatggctGTGACTTCGTATAAAATTTACATGTGGAA
GCACCGTACTGTGATTCCTATGAGCTTCCACAATTCAAAAAAGGTACATCCATGTACTCTATATACCTTCATGTGACGGCTAAGTGTAGCACCTCACAGA
ATGAGATCAAGACTGGGAGAAAGCGCGTTTGCATGCTCTGAGCTAAAACTTAAAGCGGCTAAGTCTGGATTTTAATATGTGTTGACTCTAGTGTAATGTA
GTCGGTCTGTTCCGTCTTCATAATAAGTGACATATCTGGGTTTATCGTGAGTACTTAGCAAACCGCTAGGATACCACCCGAATGAGTGCTATAGAATTTT
TGAGTGACGGCAAAAAGAGCCACAACGCTGAAGTGCTGCCGTCATCGTTGTCATAACATTCGTAGTTAAATTTTATGGGCTGCAGACACTGTTTCTGCAA
ATTATAACGCTCAATAAATCTTTTCCGCCTCACAACATATTCGTGTGTTCTGCCTTCCTCAAGTTTGTTGTGCTGCTTCATTTAccttggctctcagcca
gAGCGTTGTGCACCCTGCAAGACGCTTAATCTCATTTGAGAAAAACTTACTGATTATGCTGCGAAGAGATGATCAAATCGAATTTGATCGACAGCGTCTT
TCTAATATGACTGGATCCTCTTTGTGGCGGTTGCAAAAGCTCCCGAATTTACAACCACAACACTATTTAACACTTATTCGCAAACGTACGGTAATATGCT
GGCATAGGCTGCGCTGCACTTGAGCAAGTATCTGACCAGGCCAAGCCAACTTTTTCTGGGACAGCGGCATGAGCCAGTTTTAAATCATCTTTATCTTTGC
AAGATCTGCCCACAAAACCTGCTTAGCAATGACGCAACTCCGATAATTTCACAATCATCAATAACTCACTTGTATATATATAGCGTATTTATGCACATTC
GATTGACATCGCTTGCAAGTATTATGTGTGATTTTCACATCCGACTTTCCGCACTCGGTACGACTATACTGTTATTTAAGATTTTGCATAGCCGCAATGT
GCTCTCGACATCTTTGTCGCTTCACCAAAGGACGTCACTAATGCATTACTCAAACTATGTAGCATAACCGGACACTCTGTTCAAATAGCTCCTTTCAGAA
GGAGGAATATCGCTGTCTATATTCACAGTTGATTCAATCCATTCAACAGATCGGCGAGTGCTGACAAATGCAGCTAATAATGCTGTTCTGCCGCACATCT
TTCAAGGATTCGACATTCGAATCAGAATCGGCGGCATATAGCTTATTGAAAGCGTGAACAACAAGCCATATGACGTTCGACTTTATGACACAAAAATTCG
GTGCCGAGTGTATACTAACATTGTTTTGTTGTTAGCACGAAAAAACCTCTTTGACTTCCAGCCGTTTTATTGGTATGCGCCGTTACGttgtgacgcagta
tttCGTTCACGGAATCAAATAATCTTGTGACGTGCCTTAAAATACAGATAAAGTTGCGTGTTGAGTCTCTCGTCTCCATTCGTGTTTTTTTTTATGAAAG
GAAAAGGAACCGTAGAAAAGTTTATGGTAGCTGTCAACTCCTCGTACTCAGTGCACTGTGTGTACCTATAGtttcttgctcatcaatgAGGAATGACGAG
CTAAGCTCCTCGTCCGATAACAAATGTACCAATTTGATGACCTCACCGCTTTTCAATTCTTTGCAAACCCCGAAAAATTATTTGAGGTTCTTCACGAGGT
GTTGGGAATGGCTTATACCTCATAAAACTGTCTGGACATTCCATTTACGATAGGAAGCTATATCACTCTTTACAAGGGGGGATTCACAGGTTCACTCGGT
GGACCCTTACTAATTCAGCAGTCCTGTTGCATGATTAATGTAACGAACCACCATTCTTATTTCTAAGCATTGGACACTCTATTCGGGACCTACAATAGCC
TTTAACTGAaccggctctgccgcagagACTAGTCTAGCTTGCCTAGCACAGAAGACATCAGATCACCGTTGCTTTTACCAATTCGCCAGATGTTCACTAT
GGGGACCACGTCTTTTCCTGTCTCGACATACCACGATATTTTCGTTCTTTATAGTTCCAGGAAGAGAAGTGTGGGACTTAGTTTTTGTGACGTTCCAGTC
AATTCGCGTATAGGATGAGATCGCATCTTGATTCTACATCCAGATCAAGACAACTTTTCACTCTGTCAAACCTTTTAATTATTCTTAATTTTAAACATAA
CCTTCGACACTTTTACcagttcttcgtcgcaaAACGTCAGGATATTGTACCCATATTTGGTATCTCGATGTCTACGCATACTCTCTGAGCAGTAAGAAAC
AGTCGATCGGAAATGCACGACGCTCCTGATCATATATAAAATTTCGCAGCTTCACAAATTTTTGGACATTGATCTCGACAATCATCAACGTAGCTCTTTT
AAGAGCTGATGCCGTTTGCCTACGATCCTTACGAGGTACAATAGAACTAAATTACCCCAGTAGGCGCATGAAGACCTACTAGGGATTGACGTTCCCGTGA
AATATTAGTAGTCTGCCCCTGTGCGGGAGCTCGACCCATCATACCATTTAACACATGGCGCAGACTTTTGCAATGCAGTAGAACAAACATCTGTGGGCAC
TGATGAGGTGCTAAACATCTAAGCGATTTCTCTCTCATTCCAACATTTCTGATGTCCATCGAATCTGGCGCACTCGATAAGCCTCCTTTTATAGTACCTA
TTAAGACCCTCTCTGCGAGGAAGTTGTATTCCGCATTGAGTACGATGCTCACCGCCTTCTCAAAAGAGAGAGGGCAGACCTGGAAgtgtaagagggtgct
gatcaCAACAGTGTCTCCACTCAATACACGCGCTCGCTCGACGAGAAAGAGATTAACGACGTGGAGGGAGATagacagtcccgacttgaGGATGCTAGTG
TTGAGCGTCAAGCCCTTAGAGGTCGAAATGGAGAAAACTCTCCCTCGGGACGAGATATAATATTACCATGGAATCAGCCATGTTACAAACGGAGAGAAAG
TGTGTCGCACGAGAGAATCGGCACGAACTTACAACATTTACGTGGGGGAGGCGTCCCCAAGCGTAGAAAGCAtttaatatatataaaagaagattacagt
atggtgttcccaGATGCATACGTTAaatcttatatgaagtcacaaccaTTTTgtatgatacagaatgctggctcCTACTTGGGGATCTGTATTGGTGACG
AGGCTGACATGTCCCTGTCGTTCGAAATCGGTGGCGTAAGTCAATCTTTTCTACTGGATATTTCCCACAAACGTTAAACGTTCAAGCTTCTCTATGTTCA
AGCTCtgtacacccaagatcttgaatCAGTTCAAGCTGAGTTTCAtcctcagtacacccttaATTTTATGTAGTGAGAATCTAagcagcccttggggtgt
tttgcacaCATCTAGAAACCATTAAAATTCAGTGCAAATTTACCTTTAGGGTCTTAAGTCGTGAAATTCTTATCTAACTGGAATGTTAAGGTGCCCAGCA
CGTGCCCTACCCGCGTGTTCCTAAAGCTGGTGAGCACTCTCAGGTGAGCAAGTACCTCCGCAAGCCCTTTCGTTGCAGTTTCTTGATCTTATCTGGACCA
ACGATAGATGAGCTGTTTGATTTGTCCCACGGAGAGCATTTGAACATTTAATGACCCATTTCCTAAACCAGAAATGACTATATGCTACCAATTGCAGCCG
TTTTCTAGCACTTCGCACAGATGGGCTTTGATTCAGAAAGTTGAGTTTGGGCTTGTGTGTTTCTACCAGGAGCGGAGCTGAGAGCCTTTAAGTCAAGTAG
GACTATCAGTGATCTGATAAAAAAATGTCGTGATATCCGCTAGTAGATCATATTTTACGAAAATTTCGGTCCTGATGTGTATACTCAATTATATTCATTG
TAAATATTTACTCTGTAATACTTTACtttactatatttattaCAGTATGTTGCCCCGGCTTTCTGTGGCTTTGTATACAATCCTTAGCGCAACTTATCGG
CAAAAGTAAGGCTGTCATGAATACAAGGATTACGAAGCGATAAATGTCTACTAGAAAATTAACTCATACTACGATTGCTGACGTAGAATTTTTCACTACG
TACGCTAAAGCGACATACCTGTACCTACATGTGGCTAATATTTGTAGCGTTGACATACACATATTAATCAACTCGAAGGTGCTGCCGGCGATGCTCTTGT
TCAAGCGCATCACGCACGATAACCTTGCCCATCACATAGATACCGCTGGCAACCATCCCATAGATAGCGAGTAGATACGAGGCAACTACGCTCGCAGCAC
CGACAAAGCCCAGTAGGACAAAAGCTGTCGCACTTACGGGATCAGGTTGGTACGAAAATACCATGTTGATAAGCGAAAAGAAGAAGTAGAAAAGTGCACC
CAGCAGTCCCGTTGTAAAGTTCATGACAGCCACGAAGACCCAATTCAAAACCATACTCAGTATGTCTTCATCTCGCGACGCAAGCACGCGCATAATCATG
TGGTAAAAAGTCTGTTGCTGCGCAAAAATCTTGCCCTTTTCAAAAGCACTCCAGAATCGCGCACGTACATCCGCCATTCCAAAATCCGACCAAAGTCCCA
CAAAATTCCGtgcttttttcattttttcttCCCGTATTTGTTCAGTTCTCGCCACTTCGGCCGCCCACTTATCGGCTATTGGTTGACGTTGATTTACCAT
CGTCTTGTATGGCTCACGTACACGCCAGAACCATACCTTAGCTTCGTCGGCATAAGCCTGAGCTTTCATGTATTTAGTGTAAGCTTTGTGGTACTCTGGC
ATATTGGCAGCCTCGATAATCATGTTTTCATAAGTTGACTTCATCTCTGGAGTAACCGTGCGCAGTCCAGGCGCTAAGAGCATGAAAAACAGACCAACGA
TCCATAGCACGAGCCCAACGCGAACCTTAGGAGACTTAAGAGCCTTTTCAGCTACAGCTTTGACAAGGGCGACACCTGGGTCTCCTTCACTGGCATATCG
TGCACGTTGAACAGCATCAGAATCTGATGATCCATACACACATCATTGATTGATTAGTAGCGATTGAGAAAAGATGCAAAGCTGATTTTAAAAGCATGAG
ATCGAGTCGAAGTCGGAAAAATGCAATGGTGAAGTTTCCACGTACCCGCCGCGTCCGCATTTGGGTTACCAGGACGACGCATCTTACAATTTAGAGCTAA
ATTAGGTCTTTAAGTAATTTTTAAGATTCCTAACGTGTTTTCTCGAATTTCTTTATTATACTTTCTTCGCCTAATCTAGTTTTAAGGTACTTATTTCACC
GAGCCAATTTTCGAGCCCTAGCTAAAACAGTTTCCCCACCAAACAAAAAACccattccgcattctttCCAGGTCATAAAAGGCAGCTTTCCTTTGTTAAG
ATGCTGATACATGAGAAGGGAAGCAACAAGTTCTTGCTCTTGTGCTTTTCTTTCCCAGTATCTCTTGCCCAAAGTCCGAGAGCGTACGTTGCTTTGTAGC
TGAACGACTGGAAAAAAAATTACGGGATCTCGAAGCACAAGTTTCTGGAATTCGTTAAAGGTTAGAAATGTTGGTAAGCCGATCAATGATGGAAATGGGT
TAACTGCAAATTGTCGAATAGCCACTTCAATATTATGAACGTAGGAACTTCCAGCTTCTTGGAGCACCTCTCTTATTGAAGAAGCGTTTACAGTAACAAA
TCCTTTGGCAAAAATGGAATTGTAAAAGAAACGATAGAGCTCTAGCTCGGAAAAGGCAGCAAACGTGCATACAATACGCAAAAATTGATCGAAAGTCATT
TCAGTCATTTCATTCGTGACATCAGAAAGGCGAAGTAAGCTTTCAGTCAAAATTTGAGACCGTGCAAATACCTTATCAGTATCAACCAAGTATAAGAATC
CATGAATTGACAAATTGTCGCTTTGTGATGTCTTCTCGCTGTcaaacattcgacgaaggTATTTGACGTCACCTCTAGTCATTCCGAGTCCCTTACACAT
TTGCTCGGTCTCCACGCTCTCAAGCAGATGGCCGTAAATGGCAGATACAAAACTTCTTCGTCGTTGGGGTGACATGTGGCTTTTTGACGCCATTACTGCT
ATTCTTGTTGGCTTTAATGATCGACGCTGGATTTGACCCATGAAAAGTGCTTTACGCTCATATCTTGAAGTTTAGCTTTGGTTGAAGTTAACTGGCGCGG
GAATAAGCTCGTGCCGTTTCAGTTTGTCCACTTCAAGCACAAACAGCACCGGCACACATTGGGAGGAAATCTATATACAGCATAAGTGGACGGTCGCATA
AGCATTGGAGATTTGAAGTCTTTTTATCGTCAACACTGCACTGTGCAAGATCAAATACTTTAAAGAAAAAAGTGTTATGCTGACATCCTTCACGTGATAT
AAGGAGAAATGTGAGTAGGACAGAGCTGCTTAACGTCAGCGAATAAGCTTCGATCAAGTCATATGCATCTTCAAAATGCGACGAGATGATGACATATTTT
CGATACAAATGGATAGGAAGTTTCAGTCTCGGACCAGAGAATTGATGCCTTTTGATATCACATTTGCAAGCGTATTCAGTTGGCGGCACGCCCTTTTGGC
AAAGaatttttcttttgctgTGGTAGGCTCATGCAGTATAATCGCCAGCCAGGtggcattttttttttgctagAGATATTGAACAAATATCATCGGACTG
AATTGAAAAACCGTTTCAGGCATAACGCATTAGTACACTTAAAATTACTTTGACGGCTTTAATATTTCTCTCAAAATATGTGTACTTAACAAGTATGTTG
ACATACCATCCGATTATCTTTGAACGCTAAGATCCTAGAGCTTACATGACAAACAAATACAGCGCCAACAGCAACGTGAGCACGAATGTGAAGAAacact
ttaaaaaaaaagtgCGGGAGGCAGTAGTGCAATTTGGGGACAGCTTCACCGCTGCAAGCAAAACACCACTGTCAATTCGCACTTGGTATGCAGAGTCGCT
GTcagcttttttttcttgttgcTGCCGCATCTTTGCGGATGAAAAAGTCTGCTGCAACTTTTCTAATGCTGGTAATGTCATACTGCGTCCTGCTGCTAGC
TCAAACACGTCGCGAAGCTCAGCTTCAAAATTTGTCTGCAACGGCGGGCATGCCATCAAATCGGACTGAAATTGGATACATCAGTAAAATGAAAAGTTAG
GGTTAATAACCACATTAAAGGTGCTAATTGACTCATGTGAATATACCGTCATGACAGACTTGTAATCGCTCGAAGGTACCACTAGACCAAGATCAAATGC
CTTTATGACAAAACTATTAAAAATCCAGTCGGGCAAAGGAAGAAGCACCATGAGTGATTGCACAGGGAAAAGAGTTGCAGCGCTTGTATCTGGAATTGAA
ACTCGACCCGACTTGCTTTTGTTCACAGTAGCTGCACTTGCGACAATTTGAAAGAGCTCATCCATCTCCACTAGCACTTGCAAGAAAAGAAAGCGTGTTT
TGCGATCCCTTAATCCATCTATAACACTTTTCCCTGTCAATGCATTGATGTAATAAAAGGTGCGCAGCATCGTACACCCCCACTTCATTGCTGCATGCGC
ACACAAAATAAGTACAATACAGCACTTCACAAATGAAATAGCAAGAATAACCTTGGATATTGTGACGACAGAGTACTCGAATTCCTGTGCTCTCGAGTAA
GTCTAGTGCATAGACTGCCGAAGACTTCTCCTTTCTACGATCTCAAAAAGTGCTTAGCTTCGAACTGAACTTCAACCTGAACACCTATACTTACGACAAT
CTTTCCACAAAGAAACACCCTCTAGATAGAGGTCTAAGCAGTCCTCGATCGTCTTTCACTACGTGGAAAGCTGCACCTCCATGCACTACTATAGCCTCTG
GCAGTCTTTAGAAAGTAACAAATTCCAATCAGCAACACCTCTAAGAAACAAGAGCCTTTTGACGTACGCAATATTGAGCTGAGCAAGCCGACGCATTGTT
GTCTGAATACTGAGCACTACACGCTTCGGCCTATTTTCACAGGAATTCCCAAACATCTTGTGCAAATACTCGGCCACTTTTAATGTCTCGTCCGCTTCGA
CCATCAACAGCCACAGATCACACTCATGCAGGGTTTTTAAATCTACTGTCGCTTCAAATGTATCTGCAGAGATTTTGCTGCTATCTAACACGACGCCATC
ACAGCGCAGTGCCAAAGCATCAGTGTCGCTTTTGCTCTTATCTGATCCTTTGTATTTGTCGTGTTTCGCAGCACCTATAAGCCATGTTTTCGCACAGCGG
CCGCTAGCTGCTAGACACAACGCTATATACTGTGCAAGCTGTTTATATTCAAGCGACAACTCGCTTTTCCTCGTATACACCACGCCAACGCGCGGTAACA
TCTTGAATATTGCGGAGTTGACAATCACTCCGAAGTGGTCGCTTATTGGTGCTATACTCACAACTTAAATTAGCCAATTGTTTACCGACACTTTGCGATT
TCCCTCCTCATATTGAAGGATCCACGAGGGTCAAGATGGCGGGCGTGACGAATGAGCGCTACTGCACAGTATTGCTACAGCAGGTGACTAATGAAAAGGC
GATTCCTCCTTCACAAGATGAGATTCTGAAGGGTCTTGAGTCGCCGAAAGTGGAGCTCAAAATTCAGGCCGTAAAGAGCGCCATCCTCGCGCTCCTACAG
GGAGAGAAACTGCCAAAGGTGCTTATGCACATCATTCGCTTTTGCTCCACGCAGAGTGATCACACGTTAAAGAAACTACTTATGGTTTTCTGGGAGATCG
CACCAAAGTATGAGCAGTCAGGTACGGGTGATAAGATCGCACCCAAGCTCCTTCCAGAGATGATATTGGTGTGTAATGCCCTACTGAATGATTTAAATCA
TCCAAACGAGTACATTCGTGGCTGCATGCTGCgctttctttgcagaatcaaAGAGAAAGAAATTTTAGAGCCGCTGAAAGATGCTGTCAAGAGCAATTTA
GAGCACCGTCACTCATACGTGCGCAAGAATGCTGTCATGACAGTCTACACCATGTACAAAACCTATGGAGATATGCTGATTCCCGATGCTCCAGAACTTA
TTGAACGGTTTATCCTTTGCGAGACCGATGCTGGAGCCAGACGCAATGCTTTTCTTATGCTTAACGAATGTGCCCAAGACAGAGCCATGACATTTCTTAT
GAACGCTATGGATCAGGTCCCGAAGTTTGGAGATGGATTCTCGCTCGTGATCCTTGAGATGACGCGTAAAGTTTGTCGCCAGGACCCTGCCCAGAAAGCA
CGTTTCGTTCGCTGTGTCTTTCAGCTACTCAACTCATCATCCCCAGCTGTTAGCTATGAGGCGGCTTGGACTCTTGTCACATTGTCGGCTGCTCCCACAG
CAGTGCGTGCGGCTGCAAAAACGTACAGTGGACTGCTTAATTCACAGAGCGATAATAATGTGAAGCTTATTGTGCTGGATCGACTTGCGGATTTGAAGAA
ATACCATACAAAAGTATTGCAGGAAATTCTTATGGATATTATGCGCGCGCTCAGCTCGCCAAATCTAGATATTTGCAGAAAAGTACTGGATATTGCTATG
GATCTTGTTTCAGTACGTAACATCGATGAAGTTGTGACTCATTTGAAGCGGGAGGTAGTTAAGACTCAAGACAAGACGCGCGAAAAAGCTGGTGAGTACC
GCCACTTACTCATTAAAGCTATTCATGCTTGCGCTGTCAAGTTTCCAGAAGTTGCCAATGCTGTGGTGCATTTGTTAATGGAGTTTCTCAACCAGCCTGA
TGGTGCTATGGATGTTATTCTTTTCGTACGCGCAATGTGCGAGAGCTACCCAGATCTACGCGAGAGTATCCTACAAAAACTGATGATTTCATTCTCTGAG
ATTTCACGGGCTAAAGTTTACCGTGTCGCCCTCTGGATTCTTAGTGAATATGCAACCCTACCACCCGAAGATGGTACGGAAAGTGACACCTCTATATTTG
AGGCGGCAAATACAATATTCACTGTTATCGGTAGTCTTCCCTTGGCAACGGAAGCCATGCTCAAGACGCCAACTGAAGATACTGAAGGTCCTGAAATCGC
AGCTGGTACCGGTGCAGCGTACTCGAAGCCCGTTACTAAGAGTATCGTGCTGGCAGATGGCACGTATGCCACAGAGACCTCATATTCTGGCCCAGCTGCA
AAATCTGCGATAGCTGAAGATGAGAATGTGCCAGGTCTTCGACGATTGTTGCTGAACGGAGACTTCTTCCTTGGCGCGGCAGTGGCTTCGACTTTAACTA
AATTGTGCCTTCGTTTATCGAACGGCGATCTTGCAAGCGCTACAGCCCGCGACGTTGCGATCAAAAAGTTAGTGGTGACTTCTACTCGCTATATGTGCGC
AATTGTGGCTTTTGGACAGGCAAAGACAAGCAAGCACGAGATAGATCAAGATTCTGCACGACGTATTCTTATGTGTGTGCGTGTCCTGCTTGATCCTGCA
AGCGCCCAGGCCATGCATACTATCATCACCGAGGAGTGCCGTGATGCTTATCGCCGACTTCTCGACACGCAAAAGATGCAAGAGTCTGAAGCTGCGCGTG
CTGCTGGTGGTGATAGTGAGCCACTCACACAGGTGGACGAGCTAATTAATTTTCGGCAGCTCCGCGGCAAGAAGGCTTTGGGCTCGACTGACATTGATAT
TGATGATGGTGCGGACATTAATCGAGCCCTTGGTCAACAAGGTGACGACTCTAATGAGTATGCTGGAGCTATGCGGCACGTGCACCAGCTAACAGGTTTT
GCAGATCCCGTGTACGCCGAAGCGTACGTCACGGTGCATGACTACGACATCTTGCTGGAAATTTTAGTGGTTAATCGCATTCCCCAAACGCTAACAAACC
TTACAGTGGACCTGTCCACGATTGGTGACCTTAAGCTTGTAGAGCGCCCTCAGCCGCAAACCATAGGACCGCTTGACCAGCGCACGATTCGTGCCAACAT
CAAAGTAAGCTCTACGGAAACCGGCCACATTTTTGGCAACATTGTGTACGACTCGGCTTCAGGAGCTGAGAAGACATACGTAAATTTAAATGACATCCAC
ATGGACATAATGGACTACATCAAGCCAGCCACGTGCACGGATTCTGCCTTCCGTTCAATGTGGGCTGAATTTGAATGGGAGAATAAAGTGGCGGTGAACA
CAGACCTATCGAATGTGTTTGAGTTCCTTCAGCACGTGGTCGACAAGACAAATATGCGCTGCATGACCCCGACAGCATCCCTAGGTGGAGATACGAATTT
CTTAGCAGCCAATCTGTATGCTAAGAGTGTATTTGGCGAAGATGCTCTCGTTAATCTCAGCGTAGAAAAGCAGGATAATGGTCGCATTGCTGGGTATATC
CGCATTCGCAGCAAGACTCAAGGAATTGCACTCAGTTTGGGCGATCGCATCACAGCTGTCCAGCGCGGCAAAGATGACCAGAGCAAGCGGAAAAAGTTAC
TCGTCTAGGCTGCATTGAATAATAAGTGCAGAGTCGAATTGAGTAAAGCAGCTTAAGTTCACGTTAAGACAAGGGAGAGAATAGTAGTGCTTGGAATGTA
CTGAAAGAGAGATCTAAGAACACGTTAACAACCTAATCTTGTGAACTACTTGTTTTTTCTATAAAAGTTTGATTTGACCAGTGCTCACCATGGTGGGGTA
TCGATAATGGCAATGGTGAAAATATCTGTAGCTTCCGACTCCTCTGTTTCTCTATGGTTCCTTTCCTTTGTAAGTAGCTCAATCCCCCAAAGCGGACCAT
ACACGTTAAGGTTGTCAGCTTTGCCCACCACCCTAGGAAACGAATTGTCTCCAGTTAAGCTCCTTGTTCTTTTTCGATTGATGTTCGAATCATCATTGTG
ATGCCGAACATTGACCTCGATGCTTACCTTGACAGGAGACAAAGTGGATGTCTTTGTTTTGGTCAGGTGAGTTTCGAACCATTCGCCGAGACGATGAGAA
ACCATCACGACCGGTACATTCAGAATCTCATTCGACGCATCCTCAGCTTCCTTATCAACACCTTCCATCACGAGCACAAGATCGTTCTCTTCATTGTTGA
CAATGATGATACCAGCAGCGCCCCACTTCATCGCATTTTCTgctttcttttcaaaaaagcaTTTCCCTCTTTGGACAAGCAATATATTACCAGCAATTTC
TTCAGTTACGCTTGACAATTCATCACACCCGTCAATTGGATCAGCAATTACGACTTCTCCCTCGGGAAACGCACGTGACATTTTGAGTGAGCTTGTCGCA
CCAAAATTAGCTCCTACACAAGGTACTGTCAACGACACGTAGGAGCTGTCCGCAGTTGGTCTTGTTGTCGCGTTGCGCAGTGATTTGATGgaaagcattt
ttttgtctATTTGAACGTGAAGCGAGCAGTGCTGTTCTACAGGTAACGTCAAATCATCTTCCACCTTGTACACATGGTACTGTCCAAGATTCGGTGGACG
ATAATCATTATCgtgcccttcttcgtcatccaAAGTGTACGAATCAGCATCGAGTTCAATATTGTCGAATCCTATTCCAATGAGCAATTGGCTACCCTCA
GCAACCGTTGCTACATCAATCCAGTCACCGGTTTCTTCTCGAGTTACGCGCACGCGCCCAAGAAGTTGCTCAACTCGAAACTCACCAAGCTGAATACCTC
CGTACAAATATTGCACCAATGGGCTACTAAAATCTTGCTCCGTCATAGATTCGTCACTATAAGAAGCTGCTTTAACAAATTTTTCCAGCCATTTGATATC
AGTATTCTTTGCGATGCTTTTCTGGAGCTTGTGTTCCAGCGCTGGAAGCCATTCCTTGAGTAGACTTGAAGCTAaactttcttgatttttcgttAGAACC
TTGCTCTTTGTTGTAATGTTTGACTTTAATGTGTCTGAATCTGTCATTGCAATAAGTTTTAATTCAGACATCGCATTACTGATCGATCCAGATCGTTCCA
GATTTTTGACCGCAGCCTGAGATGCCTTGAGGAGAAGAGCAGGAGATGGTGCACGAGGTAAACACTGAGTAGTACGAGCGACAAATTCGCCTTCGTAACG
GAGAGAATAATTGACGAGCTCGTAAAATTTTGGCGCTTTACATTGCATAACTCGTCCAGCCGAAAATGGAGCGCTGGATGCCGCTTTGATGCTGCTAGTG
TATGCATCATCTGCATCTAAGATCCGCTTAACCAGCTTTGTCGGTAGGATTGGAAGTGGATGGGCTTCGGTGGTCATTACATAATTGCCCTGGCGAAAAA
AATGAGTTGTATTGAATAGCAAGTAAAGGTACTTGCAAGTTTCAGAAAGAAAAAATGACGGCATGTAATCTTCCTGTTTTTTAGTCTCGACGTCGGCTAT
GCTCGCATAGCCACATGAAGTCTTGGTATATTTTTGCAGTGAATGAACTACGTGAGCACCAGCGCGCAGCCAGGACGAGTCGTTAGTCGCCTCATGCATA
TAAAAAGTCGATTCAATCAGCTCTGGTCGTAGTGGATAACGGGCTCCATTACCATTTCGTAGTTTGAGAGGCTTCCAGTCTCTAACATTGAAATGCTCAG
AAAGAAACCCATAGTCTCGCCAAACGTGATAAAAGGCGTTCATGGAATCTGCAGCAGCCTTAATATCACCTGCAGCAACTTGCATACCAGGCCAGAAAGC
GGCAaggttttcaaaaaatacagTCGCGCTTCCGCTGCGACCGTGACAACCAGTATACATGGAAACATCTGTATACCAGTCTCCATGTTTGTTATGAAAC
AGCACAGCCGGGTACACTTGTGTAAACATATCTAAGGCCTCCTGATCACCAAAAAGCTCGTACATCTTCATTAAGTACTCGTAAAAGCTATCTGAGTTAG
TTCCTGGGCCCGATGAAAATTCAGTCCATTCACCATTAGTTGTATTAATGTGCTTTCCAAGAAGTCCAAGTTTTGAGCGGCGAATAAAGAGCGCTCGAAC
AGCTCCCCGCGCTGCTACAGCATACTTCGGATCTCCTGTCAAGACACTTAGCATGGTAAATTCAATTGAGAGTGATCCAGCACCAGCAGTTGATGCAATC
GGCGTTTCTCCCTTTGGTACACCATGCCTCAAATTAACTGTACCGATTGGAATACCCGTTGCAGTATCAAACGCAGGCAACAAACGATCTCCTAAATCTA
CGGCTAGCAGCAGTAGAGTACCGTCATATCCACCATTCGGAAATAGCTGTAGCTCTGGATCTATCGCAAAAAGATGTGCCGATAGCAGCCCACCCAGTAT
TCGTATGGTTGTCTCGAACACAGACACTTCGGTGTCCATATTAAAGTCGGCATTTTTTACCACCAATTCCACAGCACGTCGAAATTCTGTCGCGTCTTCC
AGAAGGGCTAATGTATCTAATGTATCAATTAGCGTCAACATTGGAAGGCGTCCGAGCTCGAACTCTCCACCTTTACACGAAAGGGGCAGCAAATCATCCT
GTGGGAATGCATTCGCCATATAGCCATTGTACGCATGATAGAACATTTCCTTCACTGTTTGAGTCAATGCCATGcgttcttcttcatccatgGACGTCGG
TGCAGTAAAAACAAATTGATCTCTCTGCATCAGTCCGCAAGCTACTGGTGAACACACATTCAACTCGTACTCACATTGCGATTTTTCTTCCACAGAATCA
ATGTAGGCTTCATTATCATGCAGAGCACAACACTTGACTTGCAATTTTACCGACCGACGCGTGCCTTCGTATTCACAGAGATCACCTGAGTTGTATTGCT
GCTGAGCCATGTAACCCATCCGATCAGGGTCGGCAAGTCGAGCTAAATTATCCACAGCCAAAACTCGCAATGGATGTGGCTTGTGCGCATCGAATGTACC
GAGTAAAATGCTCTTTTCCTGACCTTTAACTTGCGGATGGAACTGTCGTACGTATTGATCAAAACACCATTCGTAATGCCACCAAGCACCACCTACGTGG
TACCGCAGACAGCTTTCTCCACGCATTGTTCGCTTCAAGCGATTTTTAAAAGCGCGATAACTGTCCCCAGACAATGTGTGGAGCCCATTGAAGTGCGAGA
GGACAGCAGGACTGTCTTCAGCTTGAGTTTCACCTTGCGCAACGCCGTTGACAACCAATAATGATATGCACGTCATGAGAAATACATATGTATACGAGGT
CTTGACAGTTGCAGCAGCATGAAAAgaagaaggaagtcggcCACAAACATTCCAGCGCGGCTGACGCGGCAGCAGCTGAGACTGCATAGCTGAAATTGGA
CAATCGTTGGAAGTTAAATGTTGTACAAGAGGTCTTGTAGTCAGTATGAAAGGTACAGTCTAAAATGATATTGTACTTCAAGTCTCATCTTTTATAATCC
ATATATGAAAACTAATCATTAAACGATTTTATAATTTCTGAGACTTGGTGTTCGGGCTTTGTAAGGAAATGAGGTGTCTTCAATTTTATTTGGTATGACA
AAATATGTGATAATAAAGACAATACGATTAAAAGGTGGTCTTGGACAATGAACTTACCCAAAAAGACAGTAAATTGAATCATGGCTGCAGACTTACAACT
CTATGGTGATAGCATTAAAGATCTGCGAATGTTTCTCACGACACATTTAAGCCCCGACCAGCTGAGTCAATCGAAGTTTAAAAAATTACTTTATAGTGAG
AGGAACGATGTGCTTACACCGTCTGAGTTGCGTCAAGTATGGGAGTTGATAAGCGAGTTGCGAGCTTTAAACCCATCAACGCCTACTCTGAtgtca