Description :
From Genome Similarity Track
Location :
Scaffold_2729:1643- 2773
Transcript NameFunction/comments
Phypl_g15342hypothetical protein PHYSODRAFT_534407

Sequence
1130 bases(100 bases per row)
CCAAGGAGAACGTGAAGAGATCCCCTGGATAGCTTGGCCAGGTGGCGATCGCACCTCAACCCCCATAAAGATCCCGCCAAGAGGAGGCGGAAAGTACGGA
AAGGAACAGGAACATCCCAAGGACAACTCCCCGTCCATCAAGCTTCATTCAAGATCCAGATCGACCCTACGACGGCCAagtgaagatttccacgcggCTG
TCACCAACAATCCCCCAAGCCTNGGCCAagtgaagatttccacgcggCTGTCACCAACAATCCCCCAAGTACCGTCCATACCAGCCCAACACAAGATCGc
accgacgtcttcgccgtcaccggaagagcgaaacccgcccaaccaacgggtacacaaggtgagaagaCTTCAGCCCCCACGGACAAGCTGAGACCCCCTC
CGTAAGTTGGTAGTCCGGGCGACCGTTGGCAAGCTTGGATCGCGTCAGCAATTTCGCGAtacctgctccgccacaatggtgcgcgtgcccggatcTTCTG
GTGACTCTGGAATTCACCGTGAGTCCACCGAAGAAGATGTCAAGATCAAGGTTGAGCCAGGGATTGGTGCGTCGACGGAAGGTGAATCgccgttgtcgct
gctgaagagcgaAGGATACACCGATCGTCAGAGCCCTGGGaggagctccgacgacgtAAAGGAGGAAGGTTCAGCGATAGacctcgaggagaagcctcca
tctcctcccCAGGTCCCTTCGGGGACCCCCGCGGGTCATGAGAATATTCGCGATCCGCACGATGGAGATCTGTCGGTGAAAACCGAGGGATCTTCATCTA
ACACCACTCCTCTAGCCTCGCGGGCGACCTTGAAGAAGGAGACCGCGCgcgtgaagctgaaggcCCCGGAGTCCCACCCCGAAGATCGTAGTGCGCTTGA
GGACTGGAATGACGATCAGCTTGAAGCAGTCTTCTACCGAAAGGGGCTGTatgcgctgcttgcagcggggctgcgtagcgtagtgcgccataggaagacg
tatgactctccgagtcttaACTTGTGGTTCTCCGAACacctaagtctccgcagaggcttagatcacgctagtattactaactagagactcaaagagtcgg
tattcctaacccaaggtaaatacactcttt