Description :
From Genome Similarity Track
Location :
Scaffold_83:16429- 17795
Sequence
1366 bases(100 bases per row)
TCTTATTCTTTTAATCTTCAAGCGGTATGGAGATAACAGAACGGCAAAGCTGACAGCTCGACCGTAGAGCGACTTTGACGTAAAACCCATTCTAGTGTTG
AATAGCGAGTATAGACATAAATCGTTTTTCCAGCGAGAAGAGTGTGCGTGATCTTTAGCAGTTGCAGCAATGCCATTCCGCTGGATGGTAGTTCACTTCA
TTGTCCTTCAACACGCGGCCGCAGAAACGAAAAGGGTGCAGCTTGTCGTCATGAAGCTAATCAGAGTGCAACTTGTTAAAGTCTGAAGAGCACTGGGCGA
GGATAGGAAGCTTGAAGAACACGAAAGAAGTCTGCACTGCGAAGTGAAGACGACTTACGAAGGAGAAGGAATATTTGGAAGTGAATTTATTTGTGAGTTG
TTTAAGCTACCTGATTTATCCTTGTCCTGATTTATATGTTGTGCACATATAAATCATAAATCATGTATATCATCCAATCATCCTGTGCGTCTAATCATTG
GTAAGAACTCACCGTAATTACGCAGGATCGACTTGGACAGGTTTACGGTTTCCATGGTAACTAATAATAGTACCTTAACCGTCAACGCACAATACGCCCC
CTCAATGCGAACACGCGTGGATGCCAAGCGCTGACGTCAAGTCCTTGTGACGCGGTCCCGGCAGTCCCTTGGTCATGATGTCTGCCAACATCGCAGTTGT
TTCGCAGTGCTCCAACGTGACATCACCTCGTTTGACTTCATCGCGAATGCGGTGGTACTTGATGTCGATGTGCTTAGCCCGACCATGGTTCACAGGATTC
TTCGTCATCTTGATGCACGATTGGTTATCTTCCATGATCTTGAGCTCGGGTCCGGACTTGTCCTCTGCGGCATCCAGAGTTTTACATAGTAAGCGATGCA
CCCACTTGCCTTCTTGAATCGCCAGACTTAGCGCGAAGTACTCCGCTTCGCTTGTCGATAGCGACACACTTAATTGCTTTTTGCTTCCCCAGCTTATCGG
AGCACCCATTAGGATAAACGCATATCCTGAAGTCGACTTGCGGTCTTCATGAACACCGGCCCAGTCTGCATCTGAGTAGCCGCAGAAGTCCACCTAGTTG
TCGGGCTTAAAGCAAATGCCGTGTGACTTGGTTCCTTGTAGATAACGAATAATCCGCTTGACCGCCATCCAATGCTCGACTTGGGGGTTCTCCATGAAGC
GCGAAACGTAGCCCACAGCAAAAGCAATGTCCGGTCTTGTCGCGGTCATTAGATGCATTAAAGCACCTACTGCCTCACGAAACGGAGCGTTGATCTTGGT
TGCTGCGTCGCTTGGTGTGAGCCAAGAACTGATTTCCGTTGGGCTGATGACGGCCTTGCAGTCACT