Description :
From Genome Similarity Track
Location :
Scaffold_130:16426- 18759
Sequence
2333 bases(100 bases per row)
GTGTTCGGCACCAGATTAGACATGTCTATAGCGGATCATCCGTAGACCGATGGCCAGAATGAGCGTGTCAATCGCGTCCTCGATGACATTTTGCGCAGTG
TTGCGCTAATACGTCTAAGCGTTGGAGCTCCACGCTCCCTGTTGTTGAGTTTGCGTTGAACAACGCTTTTCATTCCTCTACAGGCTATAATTCGTTCTAC
GTGAACGGTCTCACCCACCCTCGTGTTCTGTTAACGCTACCACTATGTGGTTCAATCTTTAGTGGGGGAGAGGTAGCCCGGCTTGCTGATATCAACCCTG
CTACTGTTCAAAACAGGTAGGCGAGTTTCTCGCAACACGATTGAATGTCTTAAGACATGTGCGTGACGAAATGGCTGAAAGCCAAGACCAACAAAACAAC
AAGCATATGCTAAAAACAAAGGTTGTATTGAACGTTATGAGGTCGGAGACCAAGTATTACTCAATGCTAAAAACCTACCTACAAATGTAGTGTCCGCTGT
CTTTTAGACAAAGTTGCGTCCGCGCTTCATTGAACCATTCACGGTCGTTGCTAAGAAGGGACTTGCGTATACGCTCAACCTTCCACGCAAATTGCGCACA
CATCCTGTGCTCTACGTTGGCTTGCTTAAACCGTATCGGGATCCGTCTCACGTAAACTTGGAGGCACTTGAGCCGCGGAAGTTGGCCTTGCCATCGGTTG
CAGAATCCGAATCAGGAGGTCAAGCTGGGTCTCCATCAGGGTGTGACCCGACTCCACCGCCTGAACGCGAGCTTGTGTCGCGTCGAGCGCACTCTGGGTC
TTACCCAATGTCTCACGGAGACCACTCAGCTCGAGAAGTACCTTCTTATGCTCCTCCTTCGGTACACCGACCTCCACCAACGCTGCTCGTTGCGCAAGGG
AACCGCCAGTTCCATGTGGAGAGACCCCTGAAACGACGTCGTCGTCATGGCCAATACCAATATCTGGTGAAGTGGAGTGGGTACCCAGAGTCGGAGAACT
CATGGAAGTATGAGATTCCCCTTCGGCAAGATTGCCCCTACGCCGTGGATGTTTTTGAACATCGTGGCCAGTGTCATCTCGAGACCGAGGCCGTTTCCCA
CCACTAGTGGTGTCGTTTGGCGAGTTGGTGGTCACAATCTGACCAGCACTCGCGGCTAGCGTAGTAGCCGAAGCATAGCGCGTGCGATTGCGCAATTGGC
CTTAAGCTTGGCATAATCATACCGAAGCTTGCGTTCGAGACGCACATCGTCCACACTGATACTAGCTCTCAGAGCGTACATACTGCTGAGGCGAAGAGTG
CGGTGCACCCAGAGAATGAAGTCGTTGTCTTCTTCGTCCGTTGTTTCGTCTGCGAACAAGAGATTGGGTATACTCTCAATCGGTGGAACCGTTGCACCAC
GTGCTTGCATCTCAAGGCGTGCCTTGTACTGACTTTGCGTTGTCAGATATGACTCCAGGTAACTATCACGAAGTGCCTGGCCACTTGCCCTTCCTCGAGA
GAAGCAGCTACAGGACTAATGGTCCACGTTGCCAACGTTTGGCCAGTCATTTGATGTAGACGTTCTTTCACACTGAGTGGAGTGAACACATAGTCACGCT
GGTTCTTAAGGGTCGTGACCGTTTGCGCATGGCGCCGAGCGCTTTCTTCTCGTTGAACAGCCAACTCCTGCTGCTCATCGAGCGGGTTAGTGATGATTGC
ATCATCCGAACCGAGTGTTGAATATGGCGCATTCGCATCATCTCGTTCATAGAACGGACTTAACGTAGTAGGATGTTGTACCTCAGACATGGGTGTATCG
GACATTGTCCTTGCATCACCCAGGACACTGGTATCGCTACCAGGTCCACTGCCTCCTCCATCCCGAGGTTTGCACAAAAAGTCTTTGACTCGTTGGACGA
TGAGGACATGGTGCTAAAGCTTTGCGTTACCGTGAGGTTAACCGCAAGCGCACGGACCTCGTTGAGGAACAAAGTTCGATTGACGTTTGGGTAAACGGCA
GTCTGGTGAGGAAGGGTGTAAAGGGGTTACACATCTTAGGGTACTCGGTATCCTGTGTCTTAGACACACGGGATGGTATCCCACTGAAAGAGATATAGAA
TATCTTATCGGCTTATAGGGGCTGAAGGGTGTCAGCCACGAGATAGGAAAGATCTTAAAAGATACTAATTTAGGACATGAGTGCCTAGATTAGGTAATAT
TAGGATTAAGATATTTTATAGAGTTAAACATAAATAAAGTTCAGTTCCCCTTATGATCTTGTCTAAGACACGTGCCTTGCGAGGCGTCTTTGATCGTTGA
TCGTTAAGAGCTAGCAACATCTCGCTGAGGTAG