Description :
From Genome Similarity Track
Location :
Scaffold_17:16426- 18514
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_17-snap-gene-0.24NADPH-dependent diflavin oxidoreductase

Sequence
2088 bases(100 bases per row)
TTGTGTCGCCAATGCTACTGTACAGTACCAGCTCAGAGGCGATCAAGAGATGGCGACGATGCAGGCGCCTCCGCGTGTGCTCGTGCTCTATGGAAGCGAG
ACTGGCACAGCACAGGACGTAGCAGAGCAGATCCAGCAACAAGCGCGGAACCGCCAGCTGCAGGACACGCAATGTCACGCAATGGACGCGTTCCCGGTCA
GCCAAGTGCTTCCGCAATGCTCGATCGTCGTCTTCGTCGTTGCTACTACGGGTGATGGTGAAGCGCCAGACAACATGCGCAACACGTGGCGCGGCCTGCT
GCGCAAGaCACTTtCAAAGACGTGgTtGCAAGGAGTACAAGTTGCTGTGTTTGGGCTGGGTGACTCGAGCTACGCCAAGTACAACGCCGTCGCACGCCGC
CTCCAAGCTCGCCTCGTTCAACTGGGTGCCAGTGAGATTGTGGAGCGTGGACTCGGTGATGACCAGCATGCACTAGGCTTCTTTGGTGCGTTGAATCCGT
GGCTCGTGAAACTATGGGCTTCCGTGCTGCAGAAGTACCCAcTTCCTGAAGGCTTCGTTGTCGACGACACACCGCGCGCCATTCAACCACGTTACAAGTT
GCAGTTCCACTCAGCTGGGACTGAGGCTGCGCACCTTGTGGGCAAGTACGATCCACGTACGGACTCGTCTTCGTTTTACACCCCTCCGTCGAGTGCGATT
CACATTGAACAAGGCCTGATCATGGCGCGGCTGGTCGAAAACAAGCGCATTACCGCGACTGATTGGACTCAGGATGTCCGTCACTTGGTGTTCGACTTGG
GATCGGAGGAACTCCAGTATCCACCTGGTGCTATTGCTTGTGTGTACCCTGAGAACGTGAACGGTGTCACCGAATTGCTTGCGTATGTGGGCCAGAAGGG
GgAAACTATTGTTTCAATTATGGCTGCTGATGGCTCGgCGCAAGATGAGCTACCATCTCCAGTCACCCTAAAGGACCTCTTCACGAAGTACTTGGATATC
CAAGGAaCACCTCGACGCACCTTCTTTGCCAGACTTTCACTGTACGCCGGAGATGAAGAAGAGGTGAGTTGCTGTTGTCATGGTGACTGCCTGTCCGCTT
CCTCTCTTACACATTTAATTTGTATCCACAGAAAGAGAAACTTGAAGAAATTGCGTCGCCTGAAGGTGCCGATTTACTCTACGACTACTGCATCCGTGAG
AAGAAAACCTATGTCGAGGTTCTCTTGGATTTCCCGAGTGTGAAAGTGCCGCTCGACATACTAGTTCAGATTATCCCACGTCTGAAGCCCCGCGCCTACT
CGATCTCTTCAAGTAGCCTAGCCCATCCAGGCCAAGTGCATTTGACAGTGGCCATCGTTGACTTCCTGACTCGATACAAGCGCCGTCGAAGCGGGATCTG
CTCGTCATACTTTACATCTCTCGATCCAGCGTCATCGACTGATCCGATTTTTGTTCCCATGTGGCTGAAGACCGGTCTCTTCAACCCGCCTGATATCACG
AAAAGCATGATTCTCATTGGTCCTGGCACTGGACTTGCAGCCATGCGTGCGATCGCTCACGAACGCCAAGTACTCAACTCGAGGCTGGAGGATCCATCGA
TCGCAGGGAAGACCTCAGTATACTTTGGTAGCCGCCACCAAGCAAAGGTAGGCGTTTCCAATGGCCTGCTCCATCAAATGGAGATGATTGAGGCACTTTT
GTTGCAGGATTTCTTGTACGGTGACGAACTGCAAGGCATGTTTGCATCGGGCGGAATAAGCTCACTTCATACCGCATTCTCCCGTGACCAGGTACGGCGC
TGCCCGCTCGTAGTGGCGATGCAGCGTGCTCATTGATTATATATCTTAGGCGCATAAGATCTATGTGCAAACGCGCCTTGCAGAGCAAAAGGAGGAGGTG
TTCGAGCTGTTGACAAGTGGAGCGTACGTGTACATCGCTGGCTCGGCGAAGCGCATGCCGTCAGATGTGTACGAAGTATTGCGAGACATCCTTCGTtCGG
TTGGGAAGATGTCACTGCAGGATGCAGAGACAATCATGAAGACGCTCGTGCGCACCAAGCGCTACGTCGTGGAGTCATGGTCGTAGAC