Description :
From Genome Similarity Track
Location :
Scaffold_107:164248- 165543
Transcript NameFunction/comments
Hyaar_Emoy2809695hypothetical protein

Sequence
1295 bases(100 bases per row)
GCCACCGATGCCACGTAGTCGCCAGCGCTTCGCACCGAATCAGGACTACCTCCTCGTAGTACAGGTCAATACTGACCAGCCCTTCCGTGCCCCTAATGGA
GGACTGATGGCTGGATGGGAGAAGGTCGCCACGACCCTCAACGGCTGCAGCGCTTTCAAGATGCACCATCTCAAGGGACCGATCGCCAAGAACCGCTTTG
AGCGTCTCGTTGGTCGCCATCGGAGCTGGGTCAAGAGTGGAAGCAAACCGGAACATGCACCGTCTGAGGATGCCGCTTTCCAGAGCGTTATGATGCAGCT
CATATCCAAACTGGACGCTGCGGAAGCAGAACCAGTGACTCAGACGTTGGGGAAGCGTGGACGCCCTCGGAAGGTCCGGTCGGTCGAGGCTCTGGATCCT
GTAATGAAAAAACTGTCACCGGGACCTTCACATGTGGCGATTGCTCCGTCGCTGTTAGGTCCGCAGCCTTCTTCATCTACCTCTCTCCTCGTTGGCTCGG
AGGACCAGGCGTTGCCCATTGTGACAAAGGCTACCCGCCAACGGTTCACGCCTCGTGATGACCTCTTGCTTGCTAAGTACGTGAAGCAGTCGCTGCCTTT
CCGTGCTAAGTTTGGCGCGATTTCGGCGGCTTGGGATGATGTGGCGACCAAACTGGACAGTAACCCGGAATTTTCAAAGGACAGCATTAAGGGCCCAGTT
GTGCGCTACCGCTTCGAGAACCTTGTGTCAAAGTACCGTGAGCGCGTCAAACGGAACAGTGGACGTGTTGTGGGATCAAAAGGTACCCCAGCAGGTGAAC
TTGAAGTGCTTATGACGGAATTAGTGACTTTATTGGAGGGGGGGGATCCTGTAAGTGCTGCTCTACTGGCACAGAACGTGGCAATCGTCACGAAATCGGG
TAATGCAGTAGGAGAACGGAAGCTATCTCGTACGTCAAAAAGCCAGGATTCAACCAGTACTCATAGCGACTCATCTTCGCCGAGCTTTCAGGTCTCCGAA
GTTTCACCTGTTGCACCCCGGACCATCATCGCCCATATGTCCGATTTACATCCTATGAATACTCTAACGTTGACGAAGTCAGTGACGAAGCCAGCAGTGG
TGAACGCTTTTGGCCCTACCAGCATCGCTGAAGTTGAGACTCTTCTTCAAAATATGTTCGAGCACCAGAATCGGGCCATCGAGCAAATGGTGTTGCTGCA
GCGCGAAGACCGGCGCCTGGAGGCGGAACGGCGAGAGCGGGAGCTCGATCTAGAGCGTAAGGAGCGTGAAGAGCGAGAAAAGGAGCGTCAGGTGC