Description :
From Genome Similarity Track
Location :
Scaffold_24:16423- 22708
Sequence
6285 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACACACCAGCTGGGATGCATGCGTGGTTGGCGATG
GAGCTGTTTGCATCTTGCAGCGTTATAACGCTTGCGTGTTCTTCCCTATTTATTACTTCCCGAATCTTTTGCGAATCCTTATATTTTCTGAGTTGGATTT
TCCCAAGCCGCTGAGCGAGTTCTACCTGTGTTCAGACAAAAAAGAAGACTGGGGGCGTTTACACAAAGAATGTGTTTATCACTGGGTTACAGCGCATCGA
CCCTAGGCTAAGTTTCATGAAGAGTTCACGACTGATGGCATCTATATGAAGCATCTATTAGAGAACGCATTCTTTGATGGTGATCATACGCTACTCGAGA
CTGTACCTGTGGCGCGCATCAAGACCAACATGGAGACGTACCTTCCAGGTTGGAGTGACGGCATCTCTAGTGCGGAGAAGCCACTTGAGGCGGTACCACT
TGCTGACGAACCTGCAGAAACTGAGTTAAGCTCGAGTGCAATCGTTGACGCACCTGTGAGCAAGGACAGTGTGGAGACTGCTGGTGTTGCAGCACCAGCC
GTGCTGCAGGATCCTGCTGAAGAAGCCAAGGAAGGTTCGGAAGCGAGGAAGCGAGGAAGCGCAAGAGACGCAGAACAAAGAAGAACCCTGCAATGGTGGA
GAAGGAGACAAGTGGCTTCGATACTCAACCTCCATCAAGGGAGCCCTGCCTAAAGCGACCAAGAAGGAAGCAGAAGGCGAACGTTCGAATGTCGATTACG
TGGTAGGCCTAGGGCAGGCTATGACTACGGATGTGAAGAATTCGACGACGTACAAACAAGCACGTGCAAGCAAGTACTTGCAGCAGTGGAGAGCTGCAAT
GCTGGTGGAACTTCAATCGTTGAGAGGTCACAAGACCTGGAAACTTGTACCGCAAAGATGCCAAGAAAGTGAAGGTGATAACGTGTAGGTGGGTCTTTGC
TGTGAAGCGAGATGAGTGTGGACGAATCAAACGATTCAAAGCGCGACTAGGGATCCATGGATTCAAACAATAACTTGGGATTAACTACTCTGAGACCTAT
GCACCTGTGATCCGGTTCGAAACCATACGTGCGGCTATCAACTACGCTGTACAAAGCGGTTGGGAGATGCTGAAATTTGACGTGAAGACGGCTTTTCTGT
ATGGAGACTTGGACGAGACTATCTTCATGGAGCAGCCTCCTGGCTTCCAGGTGGATGGACCTGGATCCATTTGCAGATTGTTGAAGAGCCTGTACGGACT
GAAGCAAGCACCGAACGTTTGGAATCGCACGCTTCATGCGAAGCTTGTTGCGATGGGCTTTATTAGGACGGACGCTGACTATGGCCTATATGCATTGGAA
AGATGGTGAAGGCAAGTTGCTACTGACTGTTTACGTGGACGATCTACTGCTGATGGGATCACGTGACCTGTGTGCCGCGATCGCTGCCTCACTGCAAGAG
ACATTCGAGCTCACGACGATGGGCACAGTCAAATATCTCTTAGGCGTCAAGATCCTGATTGACCGGCCGCGCCGGCAAATAGTGTACTGCCAGAAGCAGT
ACGTACTGGAGGTGCTGAAGCGTTTTCATATGGAGAGCTGTAATGGGCTGCGCTACACCAGAAGCTACAACGCCCTCGAAGACAGACGTGCCTGCTTCGA
AGGAGTATCTTCCCTACAGAGAACTGGTGGGTGCTGTCCAGTACCTCGTTAGTGCATCGAGACCTGACATAGCTCATGCTACCCGACACCTGGGCAAGTA
TCTTGCGAGCTATGATCATATGCATTTCGCACAAGCCAAGAGGTGCTGCGTTACCTGAAGGCTACATGTGACTACGGACTAGTGATGAATGTGAAACTAC
AGACTGATGTGCAAGTTAGTGGCTACTCTGATGCTGATTTATGGCGAACGAACCCTTGGGTTTCGACGGGAATTTTCAGGGGGTACATTCCATTTGTTGG
GAGGGACAAAGATCTTCTCTTTACGCCTCTGCTCACAAGCAAGAGATCAACGCGCTCAGTGCCTGTGAAGCTGAGTACGTAGCAATGGCAGAGGCGGCCA
AGGACTTGTTGTGGCTTGCTGGCCTATGCAAGGAGTTGAGCTGGAAGCATCCAGTACCTCAACTACTGGGAGACAATCAAGGAGCCATTGCCTTAACTGC
GAAACCTGGCAAACATTCGAAATCGAAACATATCGATAACAAGTACCACATGATCAGACGCCATGTGGAGTTGAAGCAACTTACAACCCAACACATCGGA
ACTGATGATATGGTGGCCGATATAATGACAAAGGCACTTGCAGTGGTGAAGTTCACACACTTTCGCAAGGCTATGAAAGTCTTACCTATTGTGTCGAGCG
ACGACAACGTATCCGAGGACATGGCTACAACTACGACTACTGCTACTGCGTTGACTACTGCTGTTGATGCGGAGGCTGTACCTGAGCGACATTGATGAAG
ACGAGGGCGATCGAGTGGGAGTGCTGTTACTGAGTGGACTGCTATTGTCTTTGAGCTGCGACTACGCTACTACTAGGACTATGGCGGCAACTAGGATGCG
CATGTGTGATCGCGTCGACTTCCAAGTGCGTCGCCGAGATCAAGTGGGAGTGTGAGCTATAAAACTTACCTGCGTGTCGAGCGCCAGTGCATTGCAGTCT
GCCAGTGTCCGGTGCCCCCATCTACGAGCCACCGTCCACTGCCAGTGTCTGCAAAGACACATCCCAAGGACACTCATGCGCCTGGCAGTGCAGCTTGCGG
CTGCACTACAACCGGCTACACTGAGTACACATGCGTGCAATGGCGAAGGACTATACCAAGGACTGTATGCACAAGGACATCGTTGGCTGTGCGCTGCCAA
GATGGTGTACTCAAACGAGAGTGCATTTATCTAGAGTTTAGTATTGACTTATTTGCTATTTGTATACTAATCTACTTTTGCGGTACAGCGGTGTTCTGGC
GGAGGCTGCTCAACACTTTGCGTTTTGACGCCTGCCGCTCATCAGAGAGCAGCAGAGAAGAGCAGCCTCGCCAGACACCGCAGTCCTGTCGCGGCCTTTT
GCCCGGCACTTACGTGTTTACGTTACTTCCTGATTAGTTTCCTAAAGTTGACATTTAAGTGTATTTACATTTAAATGGCTCCTACTCTTAGAAGCGATCG
ACACATGGAGAACAATCCCCCCGTGACGAACCCTACGTCACCACTCACATTGTAAGAAGCTGCGCAACCCCCGAGAAACAACGGAAGCCAGCTTAGATGC
CACATCTTGGAGGTAGTTTGATGAATGAGTGAACGACTGGCGAGTGGTTGAAGTTGTCTTTTGACTTATACACCCTATATAAGAGCATTCGGATAATTTG
ACGCTGTTTTCTTAGAGGAAGATTTTCCTTTTTGCCTTTGGACTCAATTCCGCATCCGAGGTGACAGCGGCGATCGATGAGTGCGCGGCGCGGATCTCGA
CTATCGCAAGCCCACACCGATCTACCAAGTGGAAGACACACGCGACAGTAGTGACGATATGGATGTCGAAGCAGAGGAGCAGGACGTTCTTGTAGCCAAC
GAACTATGTGAAGAAAGAAGGTAAAACATCAACGCTCACAAGAGTGATGGTCGTTGGCGCATTCGACTTTCTTTTTGTATGTGCAAGTGCAACTTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN