Description :
From Genome Similarity Track
Location :
Scaffold_89:164224- 171966
Transcript NameFunction/comments
Hyaar_Emoy2808846Nep1-like protein

Sequence
7742 bases(100 bases per row)
AAGAGAACGAACAAACTGAAACCTGAAAACCTGGTCGGGGACACAGTCAAACTCGATTACAGAGACCACGGCGACAGGCACTACATCGCGTTGTCCGGCA
ACGATGGCGAATTTCAACCCTTGATCATGTGGAAACAGATGGGCAAAAAGGCTCGATGCGCGCTCAATACTGTTGGATGGAACAAAGACAAGCTGATGCC
CCTGGCCGATTCCGTTTTCCCTTTGACTTTGCATAACGCTTTCGGGAAAGGACCATGCGGAAGCCCAGACAGCGAGGACAGTGTCGAGGACAGTGTCGAG
GACAGTGTCGAGGACAGTGTCGAGGAAAGTGTCGAGGACAGTGTCGAGGACAATGACTATTGATCCATCGAAGTGAGCCTTTGCTGCACATGTCAGTCTT
CACCTGGCGTCTGCGCTTCTGCTACGAATGTTTCGGTGCCTGATTGGTGCTGTAACTGTATTGTAGACAGAGTAGCGCTGCATTGCATGACTGCATATCG
TTTGCATTTTAAGTTTACGCTGTTTTTTCATCTGAGACGTTGTGACTCCTTCTGAGCGGTCGTGGCTGGTGATGACATTGACCTGTAGCGTACACAGCAA
GAAATTGAATGAACTATGCGAGGCGTGCTCAAGAACATGTGCGCTATACTATCGGGTATACTTACTCTATCATTTCTTGATTTGCCTTCTAGATGCTGAG
TTTGTGCATATCATGAGCCTAGTAGGATCCTCACAAAAATCAATAGAATTGGGCCATGCCTTGACGTGTATTCCTCGTGTCACGACAGATCTGCTGAAGC
AAGAGTCTCTGCCATTGCTCAGACTTCTCCAATTAGTCATCCGTCTTGCATCTTGCCAAACACCGACTCGTCGACCTGCCTCAATGGAGCTGACGTTGGA
GTCTTTAGTGTTTGAAAGGTGCAGTGGCAGTAGCCATGGGGCACAACCTCTTTAAACTCAAAAATAGCTGATACGGTCGAGTTGAAGCAAGCAAGTATTT
GGTTATCTTTTTTAGTATGACATAATTATATAAGATATATTTAAAAGCTTTTTTTATTTTGGGAGCTGCTAATGAGCCTTCAGTTTTCGCTAATGGGCCT
TCACCCCATACATTGAACAAGTAATCGGATTTAAAACTCCCTAAATTGTCAAATTGTTTGTTGTACGTATTAGAAATAGCCAATTGATCTCATATCACCT
ACTATATCGTACCTCTAACCTCCCTTCTTAAATGCAAAATGGAAGGCCTTGACCAGATCACAGGAGAACTGTTTGTTTCTGTTGACGAAGCCGGTCAGGC
GCTTGATGAGGTGACACTGCCGGAAGGCTATGTTACAACAACTAAACGGCAACATAGGGTGAGTAACAGTAAGGACAGTAAAGCTATAGCAGTGAATCTG
CAATACTCATGCAGCGCTATCCACAACAGGCGATTCATTGAAAAGGTTATATTATAGCACTTAAGCATATTTAGAGGGTGAGCAGCATACAAAAGGTGTA
TTGTGTTTTCACGATCGTCTATTTTCACGTTAATGTGGAAGATGGTCTGAATACATTTGTACCAAAAACGAAGTGCCGTCGTCGGAGCTTTTTGAGGTAT
TCCTCTCAATGGTGAGAGAGAGACGTGGCAGGATGGCGTTCATCTTTACCAAGCCGGTGCGAGCTCATATTTCAATTGCTATCACCCGTCGAAGAGGCTG
CTCTATGTGGAGTTGCGAATATGGCTGGCTCAGTCTTGACTGTGAAAATTTAAAAATTAGAAGCATAAAAGTAAATCAAACAATTTGATAATTTGGAGGG
TTTCAAAATTTAGTTACTTGGTTTATGTATGGGGTGAAGGCTCATTAGCGAAAAGTGAAGGCTCACTAGCGGCTCCCTTTATTTTTTGGAAGAGCAATAC
AAATACATATAATCGCAAATAATATTGTCAGGTTTTCCTACTTTTTCCTTAGTTTTACTCCCTTATTCTTGTCAGGTAAACACATCTGGCAGTAACTATT
TTTTGGTCAAATTAAGTGGGATATCTACCCTGTTCTCGTTCAAAATACCCTCGCAACCTCAATCAAATCCATTCTAATGGGCATCGACCGGTGGCCTAGC
GGCCACCTTTCAGCTGATTCTATCGTAGATGGTAGTGATAGCGCAATTATCACTGCAGGTTTACTTAGCCTGAAATTATGAGTTATCAGCACATAAATTA
TTGTTTTGCGGTATTTTTGGTGCTACAGTGTTGCTGTTATAGCTGGTTTAGTTGTAATTCGCTTCCTGCTCGTACGCCATTGTAACACAGAGCATATTTA
ACCATTAAATAGACTATCATGAATCCATTCTATTTGTTTGAATCTCATTTTACTAATTTGTAAACTTTACCAGTGCTGTTAGACTGCAATTACCACTTTA
TAAATAAATCGGACTCAGTGGCTATGCTTGTGCAATCAGAAGACCTAATACGCCTACAGGGAGAAAAAGCGTATACGACGACCACTTGCAGTTAGGCGAA
TCGCATTAAACAGAAACTTAGTGACCAGCAGATAGAGCAAAAAGAAGATTAAAACGAAAGAGGATAAGTAGACGAAGAAGACAAGAACCGTGCTGATGAA
AACGACAGACGATAGCAATTAAGTCAAGATTCCAGAGCAGAAGCAGCGGCAACGTAAATTAGAAAGACGAAGAGAAGATTGTATAAGAGCCCAATGAATA
CCATACAATACTAAACTTTGTGGATGATAAGCTTAACGATATTTTAAGTCGCTGAGTGAAAATGCCGATAAAAATACTTCGTTACATGCGTACGAGTTCC
ACACGTTACTCAGTCAAAGGTTTTTCTTCAACTGATTTTTCAATGAACTTCGTGTGTAACAGGGTGAGCCTGTTACATGTAATTAACCCTTGATACTTGT
TAATTAGAATATTACCATAAAGGTTGATAATGTTCGTGAATATTACCATAAGGGGTAATATTCAAAACACTCACCGATTGGCTGATATGGGTCATCATAT
CAGCCAGCTCTAGCGGTCCAATCAACGATGGACGCGCACAATGAAAAGTGAGCAGGACTTTAGCATGCATTTTTGTAGATAAATATAATTAAGTTAGGAC
TAAGACATAGGTTAATGATAAGGACTTAATTATATTTATCACAGTTTTACTTTTACCAACAACTAGTCTATCTCTAGTTGTTATCCTGCCTCTGCACGTT
TGCATAGAGGCAACGAGGCACCACCAGCACTGCTGTCGGTGATAGTAGCTCCATACTGGTTGTCCAGTGTGATGCTCCGGTGCCCCGTTATACCTGGTAG
CACTTTGTAGTCCGTCCAAGAACTACAAAACCCGTTCAACATGAACACGTTGGACGGCGAAGGAGACGACACCTTTCACGGCACCCGTGAAATCTACTCT
TATTTGAGTGATGTCGAATGGAGTGTGACCGATTGAATGAGTCCGACCGTTAGCCAAGGAGCTGTCTGGTATCTGCTATCCTCAAGGGATAGGGACCAGC
AGCATTCCATACTCGCCAAGTTCTTGCAACAAGAACTGGATGCGTCGCGAGCTGAAGCGACCCTGCTGCATCAGCACGGTCACCAGCAGACTGAGATCCT
GAGATAGCAACAGTCTTAGTATGGTACTACAGCGTCGACACGTGAGCGTCGACGCGAGACTCTAAAGATAGAAGTCTCCAAGTACCGGGGAGTCGAGGAA
GACTCCCTGTTGAGATGGTTCCTCGAAGTAAACGATGCCATTCAGGCTCGCCACATTGACGATGGGGAAATTCAAGTTGCATTTTCCAAATTGAGTTTGT
CAGGAATTGCCAGACTTGGGCCCTGAGTCTTCAATTACACGATCCAAACGTGTTTAGATCGTTGGCGGTCTTTAAGACTCTGCTCAGCCAAACGTTTGAT
CCATTAAGAGCTGAGTTCATGACTCTTTTAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTCAGCACGTTCGTTACCTTGCCA
GTTGCATGGTAGTGAACCTTGTAAATGAATTCGTGTTGATCACGATATTCTTACAGGGCCTTATAGATGGTTCCGCGAGGAACCACCCATTCTGCATCGA
GTTGAAGTCGCTTGAGGAAGCGATCAAAACTGCGATGCAAGAGGACTTTAGTGTGAGACAGGCTCACACTAGCTTTACCCCCTATTGTCCTTCGAGAAGA
GTAGTGGCGGGAGGTCCAGAACCAATAGACCTCTGCAGTGTCGAGAGCGAGAGACCTCGCTTTTCGAACAACAAGTCATTGCAGAACTGCAATCGCTGCC
AGAAGTTGGGACACTACGCTTACGAGTGTAGTGCTTAACGCTCAGTGTCTCAAAACACTGAGCAAAGTGATCGACCGTCTGCCAAGAAGGGCAACGGACG
CGGGTCCGACGCTGTTGCAAAGTCACAACAGCGAAGTGGACCGTAAAAAAACGGTCAGGGTCAGTAGGGTCGGAGCGCCCTACTTATTTAGCAACCTCAA
TAGAATTTGCAAATCTATTGATGAAAGTTGCTCCAGACTCACAATCCTTATGTGTATCTGCACTTGGTAATGAGGTACCCTTCATCACCTTGAATTTAAA
CGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGTGTCGAACAACTTTGTTCGTCGCCAGTCGCTAGAGGATCATAGGCTCAAGTTCGTT
GAGCGCGTTACTACTCCTACAAGGCTGACGGTGCGCTTCGCAACAGGCGCATCGATAGCAGTGATGAAACGTGTAGTGGGATTTCACTACACGTTAAAAG
GTTTGCAGTACAATGATGATTTCATCGTACATGATTTGGACGACGAAATTGATGTCATCCTAGAATTACCCTGGATCAGAAGGTACGAGCCAAGGGTCAG
CTGGCAGCATCGAACTGCCACTTGTTCATCAGGTGGCCATCTGATGAACGTCTTGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN