Description :
From Genome Similarity Track
Location :
Scaffold_85:16421- 20507
Transcript NameFunction/comments
Physo_140378hypothetical protein

Sequence
4086 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCGGGCATGATGCGCACCTCGTTGACGTCCAGGAACATGCTGTTGTTGGGGCTGCACGTCATCTGACAGAAGATGTTGCGC
AGGTTCTCCTTGCAGGCCGAGCACAGACCGGGGATCATGCGCACCTGCGTGGACAGCCCCGTGTACTGGTTCTCGGTACAGCAGAGCATGTCGTCGCCCT
GGGCGATGGTCTCGTTGTAGAGCAGCGGGCAGTCCACCTCGAACTGCTCGCGGTTGGTGTCCGACCACTCGGAGAACTTGTTGGAGAAGCCGGCGTCGTA
CGCGTCCTCCACGGACGTCGGGTAGTAGCGGTTGGGGATGGCGACACCGGCCGTGGTGACGTTGACGTAGGACGAGTCGAAGGCCACGCAGTGGCCAGGA
GCGCGCACGAGCGCGCCGAGCTCGTGCACCAGCGCCGGGTCCTGGATGCACTCCTCCACCTTGGAGTACGTGCACATGGTGAGCTGCGCCTTGATGTCGG
CCAGGTTGGTGGCGTTGTCGGCCAGCGTCCAGGGCACGTAGCTGGAGACGGACGACGTGCCCGTTGTCGTCGTGGTCGCCGTGGACGTCGTGGAGCCCGA
GGAGCTGGCGGCGCGGGCCACGCCCAGCGGCAGCAGCAGCGACGCGAGGGCCGAGACGCGCATGATGTGGGGATGTGTGGAAGGGAGGAGAACCAGTGGA
GGCAGCCAACCCTAATCAGTCGGACGCTAGCGCTGCGCGTGCTCGACTGCCGGTAGATTTCTAAATGAGGCTGAGACTGCACCGCGGACACCTCGGACAG
CGGGAGCAGCGAGCGAAAGAGTGGCGCGGAGCTGCATGAACCCGCGACCAGAAGCGCGGATTAAAGAGACCGTCGATCAGCAAGAGCTCGACCAGAGGCG
CAGCGCGGATACTGCGCCTGCGACGGCGCCTGGGCGCGGCTATGCATGGATCCCCCGCCGACATAGTGATCACCTCGGGCGTCTGCCCCGATGAGCGGCG
TCTTGGTGCGGGCGGCTGGTCTCGCGCTGGGTTACTCACGACGCTGGCCGGCAGACCTCCATCACCGCAGACGAACGAATCAGGTCGGCGCCAGCGAAAA
CGAGGCCATCCTGCTGGTCGAGCGGATACTGTACACCCGGCTCTCCTACAGCAACCGCACCGACTCGGTGACCGAGGACCTCGGTTCGAGGCTGCATCGA
CTCGGAATATGCTCGCGCGGCACTCCTGTCGGGGCATTTAGAATCTAAATTTTAGATTCGTAAGGATGGCCGCACCGATGGCATTGCCGTGTGGTGTTGA
TACCGTCGGTGCTCCGAGTGCCTCGGACAGCAAGCGTACCAAAAGCATCCGCGATTAAAGCGCAGCAAAATTAACGCCGTCAGCTCAGCTTAGAGTCGCA
CCATGCCAAGTGAATGCACTCTCTGCAGAGTCTGCTTTCACCAAGATGGACGCGCGGGAGAAGCTGCTTCCTGAAGTGCAAGAAGGATACACGGTGCAAC
GGGGGCAACATCAAGGGCAACACGGACTCAGAGTGGTACAGCTGCTTCTGAAGCGTCGCATTACAAATGTACCTGTCGTGATTAAATAGCCATTCCAAGT
CGATCATTATCAATATGAATGGATACATTGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN