Description :
From Genome Similarity Track
Location :
contig_14:164162- 165289
Transcript NameFunction/comments
g3664.t1hypothetical protein

Sequence
1127 bases(100 bases per row)
CAGAGCTCAGTCTCGAGGATGGAGAATACTTTAACTGACATTGCCACAGGTGACGCAGCTTCTTCACAGCAGGTAAACAACTTTGTTGATAGTCAATTTG
ATCGTAGCAGCGAGACGAAGGCGCCGAGTCTTGCTATGCTGGATCTTTACATCGACCGTGTTGTGCTCGACGATCACCCAACTTTCGAACTAGCAGACCG
TCTCGCCGCACAATTGCGGGCCTTGTACACTGCGTACATTCGAATGCAGCAGCTTCAGCCATGGCAGCTTTCACTCCAGCGTCTTGACGAATTCTTCTCC
AGTACTACCGACAAATTGGCGGAGGCAGCTGGACGCAATCGTGCTATGGCAAGAACTGATCTGCTACCACACCAAGTAATCCAGGAAGCGAACCAGCTAC
TGACAGATTTGGAGGCCCTGAGCCAACTCCACCTGCAAATTGTAGGCAAAGCGAATGAGCTGCGTGATGCCGGCACTCGTGCTGGATCTGCGCTTCAGCA
TCGAGTCAAGTCACGCCATCGCATGCAGCCTATTGATTTATCTCGCGTGGAGGCAATCTTGGAACTTCTGGAAGCGGGAACGGATAATCAGCAAAAACAA
GGAGTGGAGAAGAACGACAAGCTGCAGACGACATCTCGGAAAATCTCTGAGCGTTTATCGACGCTTTCTTCTGCCTCGACTCACGCGTTGCAGACTGTGT
TGATAGTGGAGAGCGTCGGTGGCGACAGTCAACTCAATGAGGTGTCATTTTGGAGCCCTAGATTTTACGTGGTGCTCCGGGTGAACGGGAAAATTGCGTG
TTCGACGAAAATTCAACCTTGGTCTCGTGGTGAGGTTCGCTTTGCCGAAAGACTGTGCCTCACACTACCATTTTTCCCCTCCTCGGTCTGTGCGGAAGTT
TATGAACGACGACGGCTACTACGCGATGAGCTCTTATCCACGAATGCTGTTCCTGTGGTTGTACCCGGGCAAAACGTTGCTCAGTATGCACCCTCACGAT
CGCGGTCATCGCTTTTCGATGGTTGGGGAAACAATAACGCGGACCACCTCGTGCCCGCCGCTAGCCTAACACCCAGTGATGAGTGGTACCAATTCAGTAG
CACGACGCCAATCGCACGAACGCAGTG