Description :
From Genome Similarity Track
Location :
Scaffold_76:16413- 17429
Sequence
1016 bases(100 bases per row)
TTTGAACGGGCAACAATGCGGCCTAAGCTTGGCGCGTTGAGGGCTAAATACGGAATACCCCTGCACTGGGTCACCGTTGCCCCCCCCCTGAGCATCACGC
CCTTGAGCTGCATCGTATTGCTGCGCTGCGAGAGCTGAACGCGTGGAATCAACCCGACGTCGTTTTCCAGCAAAAAGAATGCCGCCAGGAGGACTTGCCG
GAGTCGGTGCACTGTCACGCCCGGGGAAGACTGGCCGTTTCGAATGAATACCCTGCTTTGGCGGCGCGCGCCTTCGAAAAATGTACAGAGCAAATTTTAA
ACGACATTGTTTTGTGCAAAGCGGCTAGTGGTACACGGATTTCTCGAGACTGTAACCAGCGGAAGGTGGGGGCCTATGGAACCATAGCAGCATTCGCAGC
AGTAGTGGAGCCGCAAGCAGATGGACGTCTACATATTCACATGACGCTTTACGGATCTAGGTATAATCCAACGCTGCTCTCGAGGATAACCTGCTCTCCT
GTATTGCGCCAGCGCGCTGCACAATTCCTCGAATCGATATGCTGCACTAACTTCGACGCTTCGGTGCATGAATGGCGCAAAAGCTGCATCGATAATGGAG
CCTTGCCAAAAGCTTTCGAAATTCCTCTTCCGGACGCAGCTGCTGACTTTGGCGCTTTTCTCAAGGCTGCGCAAATGCGCGCAGCTACTACTCGCACACA
TCGACCTGTTTCAAAGGCAATCGAGGAAAGCAAATGTGTCGTCTGGCTAGACCCGCGGGTGAACACGAGGGGCCGACCTCGCCATTGATTGTTATCCGCG
AACGCAAGGGTAACCCTCGAACCGGTATCAGGCCCATTGTGGTAGGCCACGAGTTGAAACCGCACATCCTCCGCGCTATTGACAACGGGTATTCTTACGA
GATGGGTCAATGCTTCCGCCCGCATTGCGAAGGGCCAATATTATGGGAGCTCTCGAGGCCGGCGACAGACATACGAGTCGTCGAAACAAATCTTTTATTG
GCTGCGTTAACAGCTT